هر چه بیشتر یاد بدهید بیشتر یاد می گیرید.مجله آموزشی آسان بود

نمونه سوالات زیست شناسی۳ دوازدهم تجربی

به نام خدا

سوالات امتحان درس زیست شناسی3 دبیرستان امام حسین (ع)
1397 نام کلاس: مدت امتحان:80دقیقه
نام و نام خانوادگی: نام دبیر:خاقانی
ردیف متن سوالات نمره
1  درستی با نادرستی عبارات زیر را مشخص کنید.(از کلمات غلط و صحیح استفاده کنید.)

أ‌)        صفت گروه خونی Rh یک صفت پیوسته و تک جایگاهی است.

ب‌)     مقدار یوراسیل موجود در mRNA همیشه با مقدار آدنین برابر است.

ت‌)     تعدادرمزه ها درmRNAهای تمامی جانداران یکسان است.

ث‌)     DNAی  باکتری های حاصل از دور اول همانندسازی در محیط کشت حاوی 14Nپس از گریز دادن نواری در انتهای لوله تشکیل دادند.

2
2 جاهای خالی را با کلمات(  جرم ،کدون ، چگالی ، ناقل ، فنیل کتونوری) مناسب پر کنید.

أ‌)        در سانتریفوژ میزان ............. مواد بر اساس .................. است.

ب‌)     به توالی های ......نوکلئوتیدی mRNA ،............... می گویند.

ت‌)     منظور از ........... فردی است که بیمار نیست اما...........بیماری را دارد.

ث‌)     با تغذیه نکردن از خوراکی هایی که ............ دارند، می توان مانع بروز اثرات بیماری ............... شد.

2
3 در مورد انواع مولکول RNA به سؤالات زیر پاسخ دهید:

الف ) با توجه به این نکته که مولکول tRNA تک رشته ای است، بخش های دو رشته ای موجود در مولکول tRNA چگونه حاصل شده است ؟

ب) کدون اولین آمینو اسید در هر زنجیره پلی پپتیدی بر روی mRNA چیست ؟

1
4 در مورد ساختار شیمیایی نوکلئیک اسید، به سؤالات زیر پاسخ دهید:

الف) در حالت طبیعی، نوعی باز آلی که در ساختار DNA شرکت ندارد را بنویسید.

ب)پیوند بین نوکلئوتیدهای موجود در یک رشته پلی نوکلئوتیدی، چه نام دارد؟

1
5 الف) اگر ترتیب بازهای یک رشته ی DNA به صورت TCGAAGCT باشد، ترتیب بازهای رشته ی دیگر چیست ؟

ب) آنزیم هلیکاز ، در همانند سازی DNA چه نقشی دارد؟

1
6 شکل زیر مربوط به چه ساختاری است؟ محل مشخص شده را نامگذاری کنید.

.

1
7 گریفیت برای بررسی این که آیا کپسول عامل مرگ موش هاست یا خیر، چه آزمایشی را انجام داد. 1
8 به سوالات زیر در مورد تنظیم بیان ژن در پروکاریوت ها پاسخ دهید.

الف) در حضور کدام ماده ، مهار کننده به اپراتور متصل باقی می ماند؟

ب)در هنگام حضور مالتوز، رونویسی ژن مربوط به آنزیم تجزیه کننده مالتوز، توسط کدام آنزیم صورت می گیرد؟

1
9 اگر فردی برای گروه خونی ABO فقط آنزیم A را داشته باشد؟

1.        گروه خونی این فرد چیست؟

2.       این آنزیم توسط کدام الل بیان شده است؟

1
10 یکی از اصطلاحات « خالص» یا  « ترجمه » را تعریف کنید 1
11 در مورد ترجمه به سوالات زیر پاسخ دهید؟

أ‌)        در کدام مرحله ریبوزوم روی mRNA جابجا می شود؟

ب‌)     در کدام مرحله همۀ اجزای ترجمه از یکدیگر جدا می شود؟

1
12 در مور توالی نوکلئوتیدی در mRNAی زیر به پرسش ها پاسخ دهید.

mRNA = UAAGUCAUGUUUCCGUGGAAUUGAAAU

الف)اولین پادرمزه که وارد جایگاه A ریبوزوم می شود کدام است؟

ب)آخرین رمزه که در جایگاه P ریبوزوم قرار می گیردف کدام است؟

پ)رمزه پایان در کدام جایگاه ریبوزوم قرار می گیرد؟

ت) پلی پپتید ساخته شده چند آمینو اسید دارد؟

1
13 چرا در زیر میکروسکوپ الکترونی، اندازه رناهای ساخته شده هنگام رونویسی متفاوت دیده می شود؟ 1
14 الف)انواع ژنوتیپ های احتمالی برای صفت رنگ گل میمونی را ذکر کنید.

ب)در فونو تیپ گرو های خونی رابطه بین کدام الل ها هم توانی است؟

1
15 در رابطه با بیماری هموفیلی به سوالات زیر پاسخ دهید.

أ‌)        الل مربوط به این بیماری روی کدام کروموزوم قرار دارد؟

ب‌)     شایع ترین نوع هموفیلی مربوط است به کمبود کدام عامل است؟

1
16 اگر زنی ناقل هموفیلی و ناقل فنیل کتونوری با گروه خونی O  با مردی هموفیل و مبتلا به PKU با گروه خونی AB ازدواج نماید. چقدر احتمال دارد اولین فرزند آنها گروه خونی B را داشته باشد؟ 1
17 الف) از آمیزش ذرت با ژنوتیپAABBCC با ذرت با ژنوتیپ  aabbcc  زاده های  حاصل در کدام طیف قرار می گیرند؟

ب)ژنوتیپ زاده ها ی حاصل از این آمیزش را بنویسید.

1
18 زنی با گروه خونی B با مردی با گروه خونی A که هردو دارای ژنوتیپ ناخالص هستند، ازدواج می کند.

1.        انواع فنوتیپ های جدید احتمالی در فرزندان کدامند؟

2.       احتمال تولد فرزندی با گروه خونی O چقدر است؟

1
مجموع نمرات 20

موفق و پیروز باشید.

به نام خدا

سوالات امتحان درس زیست شناسی 2 دبیرستان امام حسین (ع)
1397 نام کلاس: مدت امتحان:80دقیقه
نام و نام خانوادگی: نام دبیر:خاقانی
ردیف متن سوالات نمره
1 درستی با نادرستی عبارات زیر را مشخص کنید.(از کلمات غلط و صحیح استفاده کنید.)

أ‌)        در بیماری دیابت شیرین ، بر اثر تجزیۀ چربی ها PH خون کاهش می یابد.

ب‌)     بافت استخوانی فشرده در دو سر استخوان ران، به صورت واحدهایی به نام سامانۀ هاورس قرارگرفته است.

ت‌)     در پلاناریا دو گره عصبی در سر جانور، مغز را تشکیل داده اند.

ث‌)     حساسیت یاخته های مخروطی به نور ، بیشتر از استوانه ای ها است.

2
2 از کلمات (  سریع، آمینو اسید ها، قدرتی . مجرای شنوایی ،دور برد ، پرده صماخ ، برخی دارو ها . جریان خون ، تند ،)جا های خالی را با کلمات مناسب پر کنید.

أ‌)        در انتهای................................. استخوان چکشی ................................قرار دارد.

ب‌)     موادی مانند ....................................    و ................ ...... از سد خونی مغزی عبور می کنند.

ت‌)     پیک های ........................  پیک هایی هستند که به................................... وارد می شوند.

ث‌)     تار ماهیچه ای نوع ....................برای  انقباظات................... و ................................متخصص شده اند؟

2
3 از اصطلاحات زیر یکی را تعریف کنید.

الف)لکه زرد         ب) اعتیاد

1
4 نوع گیرنده ها را درهر یک مشخص کنید:

گیرنده اکسیژن در آئورت:

گیرنده های فرو سرخ:

1
5 در مورد پتانسیل عمل به سوالات زیر پاسخ دهید.

در شروع پتانسیل عمل کدام کانال های دریچه دار باز می شوند؟

در پایان پتانسیل عمل کدام پروتئین فعالیت خود را افزایش می دهد؟

1
6 اسکلت بیرونی در حشرات و حلزون ها به ترتیب چه نقشی دارند؟

هدایت جهشی در کدام نوع نورون ها دیده می شود؟

1
7 در تشریح چشم به سوالات زیر پاسخ دهید؟

عنبیه شامل چه ماهیچه هایی است؟

چرا زلالیه بطور کامل شفاف نیست؟

1
8 ویژگی مهم گیرنده های درد چیست؟

چرا بعد از مدتی اثرات درد و گرفتکی ماهیچه ای کاهش مییابد؟

1
9 وظیفۀ هر یک را بنویسید.

شیپور استاش:

لالۀ گوش:

1
10 چه بخش از اسکلت استخوانی بدن در تولید یاخته های خونی دخالت دارد؟

ماهیچه ها چگونه در حفظ دمای بدن دخالت می کنند؟

1
11 بخش های مشخص شده را نامگذاری کنید. 1
12 در مورد هورمون های بخش پسین هیپوفیز به سوالات زیر پاسخ دهید.

الف) در کجا ساخته می شود؟

ب)نام آنها را بنویسید.

1
13 در هر یک از حالات زیر نوع ماهیچه را مشخص کنید.

افراد کم تحرک:

وزنه بردار:

1
14 در مورد انعکاس ها پاسخ دهید.

الف) توسط کدام  بخش دستگاه عصبی محیطی تنظیم می شود؟

ب)مرکز تنظیم این انعکاس ها کدام بخش است؟

1
15 هر یک از اعمال زیر توسط کدام بخش مغز انجام می گیرد؟

الف) تنظیم تعداد ضربان قلب:

ب)پردازش نهایی اطلاعات حسی:

1
16 در مورد دیابت نوع 2 به سوالات زیر پاسخ دهید.

الف) در چه افرادی ظاهر می شود؟

ب) یک مورد از راه های پیشگیری آن را بنویسید.

1
17 هریک از اعمال زیر توسط کدام هورمون انجام می گیرد؟

الف) افزایش فشار خون:

ب) نمو دستگاه عصبی:

1
18 هر یک از هورمون های زیر در چه بخشی ساخته می شود؟

الف) هومون پرولاکتین:

ب)اکسی توسین

1
مجموع نمرات 20

موفق و پیروز باشید

بسمه تعالی دبیرستان امام حسین (ع)

امتحان میان ترم درس زیست شناسی3

نام و نام خانوادگی:

نام دبیر: خاقانی

مدت امتحان:80دقیقه

ردیف سوالات نمره
1 درستی یا نادرستی جملات زیر را بنویسید.(از کلمات درست و غلط استفاده کنید)

أ‌)        جفت شدن بازهای مکمل، اصل چارگف را توجیه می کند.

ب‌)     پس از اتصال بخش بزرگ و کوچک ریبوزوم به یکدیگر، tRNA آغازگر با کدون آغاز رابطۀ مکملی برقرار می کند.

ت‌)     رخ نمود صفات تک جایگاهی، غیرپیوسته است.

ث‌)     در افراد PKU آنزیم سازندۀ فنیل آلانین وجود ندارد.

2
2 از کلمات (فسفو دی استر،هیدروژنی) استفاده و جاهای خالی را پر کنید.

أ‌)        در یک رشته پلی نوکلئوتیدی ، پیوند بین دو نوکلئوتید را پیوند .......................... می نامند.

ب‌)     رمزه آغاز باعث آغاز ..................... می شود و معرف اسید آمینه .................... است.

ت‌)     بیش از کشف قوانین وراثت ، توسط .دانشمندی به نام............... تصور بر این بود که صفات فرزندان ................ از صفات والدین و ......................... از آنهاست.

ث)در گروه خونی ABO بین الل های A و O رابطه .........بارز و نهفته.......... و بین الل های B و Aرابطه......هم توانی......... وجود دارد.

ج)     هموفیلی یک بیماری .................... است و الل مربوط به این بیماری روی کروموزوم........................... قرار دارد

2
3 أ‌)        گریفیت برای بررسی این که آیا کپسول عامل مرگ موش هاست یا خیر، چه آزمایشی را انجام داد وچه مشاهده کرد؟

ب‌)     بین قند یک نوکلئوتید و فسفات نوکلئوتید دیگر در مولکول دنا چه پیوندی بر قرار است؟

ت‌)     برای بیان نوع آمینو اسید در پلی پتتید ، توالی نوکلئوتیدی رمز دنا چند تایی است؟

1
4 به پرسش های زیر در مورد تنظیم بیان ژنها پاسخ دهید:

أ‌)        توالی افزاینده در کدام نوع سلولها وجود دارد ؟

ب‌)     مانعی که در تنظیم منفی رو نویسی از پیش روی رنا بسپاراز، جلوگیری می کند کدام است؟

ت‌)     تنظیم بیان ژن در مورد ژن آنزیم تجزیه کننده مالتوز در اشرشیا کلای از کدام نوع است؟

5/1
5 انواع پروتئین های ساختاری و نقش آن را بنویسید. 1
ردیف

ادامه سوالات

نمره
6 به سؤالات زیر پاسخ دهید:

الف) در همانند سازی DNA ، انزیم هلیکاز موجب گسستگی کدام پیوندهای این مولکول می شود؟

ب) تعداد دوراهی همانندسازی را در باکتری ها و سلولهای یوکاریوتی با هم مقایسه کنید

1
7 ادامه سوالات

  1. دمای بالا چه تاثیری در فعالیت انزیم ها دارد؟
  2. چرا در زیر میکروسکوپ الکترونی، اندازه رناهای ساخته شده هنگام رونویسی متفاوت دیده می شود؟
نمره
8 اگزون(بیانه) را تعریف کنید. 1
9 ‌أ)        ساختار سوم پروتئین ها چگونه بوجود می آیند؟

‌ب)     اگر ترتیب نوکلئوتید ها در یک رشته دنا TACGATGC باشد، ترتیب نوکلئوتید ها در رشته مکمل ان را بنویسید.

‌پ)      در پیش هسته ای ها رونویسی توسط کدام آنزیم انجام می گیرد؟

‌ت)       در رونویسی مکمل نوکلئوتید آدنین دار کدام نوکلئوتید قرار می گیرد؟

2
10 منظور از دنای هسته ای چیست؟ 1
11 منظوراز فعالیت نوکلئازی دنابسپاراز چیست؟

آزمایشات مزلسون و استال چه نتیجه ای نشان داد؟

1
12 شکل را نام گذاری کنید.

الف)هر یک از شکل الف ، ب و پ کدام حالت را نشان می دهند.

ب) کدام حالت فعال رنا ناقل است؟

ج)کدام شکل حاصل تا خوردگی اولیه رنای ناقل است؟

                                                                                                          الف                     ب                        پ            

1
13 در مورد ترجمه به سوالات زیر پاسخ دهید.

1.        در مرحلۀ آغاز ، رنای ناقلی که مکمل رمزه آغاز است در کدام جایگاه قرار می گیرد؟

2.        جایگاه P محل قرار گیری کدام رنا است؟

3.        در مرحلۀ آغاز ، جایگاه P در رناتن ابتدا توسط کدام رنا اشغال می شود؟

4.        جایگاه A رناتن محل قرار گیری کدام رنا است؟

1
14 در مبحث ژنتیک به چه افرادی ناقل می گویند؟ 1
15 به سوالات زیر پاسخ کوتاه دهید.

1)       انواع ژنوتیپ های احتمالی برای فردی که گروه خون B دارد را بنویسید.

2)      در چه حالتهایی می توان با دیدن فنوتیپ، ژنوتیپ را تشخیص داد؟

1
16  هر یک از صفات زیر از کدام الگوی ورانتی تبعیت می کند؟

1.        رنگ موهای اسب

2.       حالت موی انسان

1
17 1)       مثبت یا منفی بودن گروه خون به چه چیزی بستگی دارد؟

2)      در چه صورتی فرزندان تمام ژن های خود را از یک والد دریافت می کنند؟

1
18 مردی با گروه خونی A با زنی با گروه خونی B که هر دو دارای ژنوتیپ ناخالص هستند، ازدواج می کند.

1.        انواع فنوتیپهای جدید احتمالی در فرزندان کدامند؟

2.       احتمال تولد فرزندی با گروه خونی A چقدر است ؟

1
19 اگر مردی هموفیل با زنی ناقل هموفیلی ازدواج کند، چه قدر احتمال دارد اولین پسر آنها مبتلا به هموفیلی باشد؟ 1
20 صفات تک جایگاهی و صفات چندجایگاهی را تعریف کنید. 1
مجموع نمرات 20

موفق و پیروز باشیدو نمرات خوب بگیرید. خاقانی

به نام خدا امتحان نوبت اول در س زیست شناسی3 وقت: نمره
اداره آموزش و پرورش ملکان نام و نام خانوادگی: دبير: خاقانی
دبيرستان امام حسین (ع) نام کلاس:............ دی ماه 1397
ردیف سوالات نمره
1 صحیح یا غلط بودن عبارات زیر را مشخص کنید.

آ) مکمل بودن باز های آلی در مولکول رنا(RNA) نتایج آزمایش های چارگاف را تائید می کند. غلط.

ب) انرژی لازم  برای تهیه پلی پپتید  از مولکول های پر انرژی مانندATP  به دست می اید. صحیح .

پ) در هم توانی صفت در حالت ناخالص، به صورت حد واسط حالت های خالص مشاهده می شود.. غلط .

ت) مقاوم شدن باکتری ها نسبت به داروها، نشان دهندۀ این است که موجودات زنده می توانند در گذر زمان تغییر کنند. صحیح .

2
2 جاهای خالی را با کلمات مناسب پر کنید.

آ)گریفیت باکتری های پوشینه دار کشته شده با گرما را به موش ها تزریق کردو موش ها ........ سالم ماندند...............................

ب) نواحی که درمولکول دنا وجود دارد ولی رونوشت آن در رنای پیک سیتوپلاسمی حذف شده ............. میانه )اینترون).....  می گویند.

پ) رخ نمود صفات ........ تک جایگاهی.................، غیرپیوسته است. در صورتی که رخ نمود ........ صفات چند جایگاهی................. رخ نمود های پیوسته ای دارند.

ت) ژنگان به کل محتوای مادۀ وراثتی گفته می شود و برابر است با...... مجموع محتوای مادهٔ وراثتی هسته ای وسیتوپلاسمی.............................

2
3 گزینۀ مناسب را انتخاب کنید.

آ)کدام گزینه نتایج آزمایش های ایوری و همکارانش را بدرستی بیان می کند.

عامل اصلی و مؤثردر انتقال صفات، دِنا است.                                                                    عامل اصلی و مؤثردر انتقال صفات، پروتئین است

ب)در فرایند ترجمه کدام گزینه شرکت دارد؟

رنا بسپاراز                                                                                                                                   رنا تن

پ)در بیماری فنیل کتونوری (PKU) کدام مورد وجود ندارد.

آمینو اسید فنیل آلانین                                                                                                            آنزیم تجزیه کنندۀ فنیل آلانین

ت) کدام گزینه گونه زایی هم میهنی را بهتر بیان می کند.

پدیدۀ کوه زایی                                                                                                                          پدیدۀ چند لادی

2
4 به پرسش های زیر پاسخ  کوتاه دهید.

آ) منظور از جایگاه فعال آنزیم چیست؟  جایگاه فعال بخشی اختصاصی در آنزیم است که پیش ماده  در آن قرار می گیرد.

ب) تغییر شکل گویچۀقرمز در بیماری ،کم خونی حاصل از گویچه های قرمز داسی شکل ، مربوط به کدام پروتئین است؟ هموگلوبین

پ) در تولید مثل جنسی ،  ارتباط بین نسل ها توسط کدام یاخته ها بر قرار می ماند؟ یاخته های جنسی (گامت یا کامه)

ت) عاملی که توان بقای جمعیت ها را در شرایط متغیر محیط افزایش می دهد چیست؟ تغییر پذیری مادۀ وراثتی( جهش)

2
5 با توجه به شکل به پرسش های زير پاسخ دھيد.

الف) موارد شماره گذاری شده را نام گذاری کنيد.

1-     گروه فسفات

2-    قند 5 کربنه

3-   باز آلی نیتروزن دار

1.5
6 سه مرحلۀ رو نویسی را نام ببرید. آغاز – طویل شدن – پایان . 1.5
7 جدول زیر را کامل کنید.

DD,Dd

گروه خونی A

گروه خونی

1.5
8 نوع جهش را در هر یک از تصاویر زیر مشخص کنید.

1-     ........,واژگونی..............                                    2-  .....جابجایی...................             3- ...مضاعف شدگی.............

1.5
9 در مورد همانند سازی به سوالات زیر پاسخ دهید.

آ) کدام آنزیم پیوند های هیدروژنی را می شکند؟ هلیکاز.

ب)کدام آنزیم پیوند فسفو دی استر را می شکند؟  دنا بسپاراز.

1
10 الف) در چه هنگامی یک آمینو اسید بار مثبت و  منفی به خود می گیرد؟ هنگامی که آمینواسیدی در محیط آبی )یاخته( قرار می گیرد، گروه آمین بارمثبت (+) و گروه کربوکسیل بار منفی (-)به خود می گیرد.

ب)چرا با قرار گرفتن عامل آزاد کننده در جایگاه A ریبوزوم ، ترجمه به پایان می رسد؟چون این پروتئین ها باعث جداشدن پلی پپتید از آخرین رنای ناقل می شوند. همچنین این پروتئین ها باعث جدا شدن زیرواحدهای رِناتَن از هم و آزاد شدن رنای پیک می شوند.

1
11 در مورد تنظیم منفی بیان ژن به پرسش های زیر پاسخ دهید.

آ)در حضور کدام ماده مهار کننده از توالی  اپراتور جدا می شود؟ لاکتوز

ب) این نوع تنظیم معمولاً در کدام جانداران دیده می شود؟ در پیش هسته ای ها

1
12 در خانواده ای که مادر ناقل است  دختری با گروه خونی AB  و بیماری هموفیلی متولد شده است. با رسم مربع پانت به سوالات زیر پاسخ دهید.

الف) چقدر احتمال دارد که فرزندی با گروه خونی O متولد شود؟

گامتها i
i ii

مادر ناقل هموفیلی وبا گروه خونی  A   × پدر هموفیلی با گروه خونی B

Y i

ب) احتمال تولد پسری با بیماری هموفیلی چقدر است؟؟

گامتها
X
Y XY

مادر ناقل هموفیلی وبا گروه خونی  A   × پدر هموفیلی با گروه خونی

Y i

1
13 الف) منظور از ژن نمود خالص چیست؟  یعنی هر دو آلل  مربوط به یک ژن ، در کروموزوم های همتا ، مشابه باشند.(DD,dd).

ب)کدام پدیده می تواند باعث حذف آلل های سازگار، از محیط شود؟ رانش دگره ای

1
14 در رابطه با تغییر گونه ها به سوالات زیر پاسخ دهید؟

آ) اندام هایی را که طرح ساختاری آنها یکسان است، ولی  کار متفاوتی دارند چه نامیده می شوند؟ ساختار های همتا.

ب) گونۀ جدیدی طی آمیزش گامت های طبیعی دو گیاه با عدد کروموزومی 28 =n4 و 14=n2 به وجود آمده است. گونۀ جدید چند کروموزوم دارد.   کروموزوم  21 = 7 +14

1
مجموع نمرات 20

دیدگاهتان را بنویسید

نشانی ایمیل شما منتشر نخواهد شد. بخش‌های موردنیاز علامت‌گذاری شده‌اند *

للل
  • 0
  • 0
  • 0
  • 243
  • 75