آزمون ساز زیست شناسی۳

Home
میتوانید یا انتخاب(های لایت کردن) سوال و فشردن دکمۀ افزودن سوال، ورقۀ امتحانی خود را بسازید. دکمۀ چاپ را بزنید!

همواره نمونه سوالات ، دانش آموزان را برای ارائۀ بهتر درس پخته تر می کند. دانش آموزان با دیدن نمونه سوالات امتحانی ، دید بازتری نسبت به درس پیدا خواهند کرد. بدیهی است که هر چه تجربه بیشتر شود تبهر در کارها از جمله شاگرد اول شدن هم به مراتب بالا خواهد رفت . دوستان ، نمونه سوالات را از دست ندهید و خیلی البته ، خلاقیت خودتان را نیز فراموش نکنید و در پی کشف سوالات جدید از متن درستان باشید. مثال ورزشکاران که یاخته های ماهیچه یشان را تقویت می کنند ، شما هم یاخته های عصبی مغزتان را پرورش دهید.

فصل۱ مولکول های اطلاعاتی

بارم ) نوبت اول : ۶ نمرهخرداد: ۲٫۵ نمرهشهریور: ۲٫۵نمره – دی ماه ۲٫۵.

الف) جاهای خالی را با کلمات مناسب پر کنید.

١- ویژگی های یاخته های بدن ما تحت کنترل …………………………………………………….. است.

۲- ریبونوکلئیک اسید یک ………………………………………………………… است که از واحدهای تکرار شونده ……………………………………………………………. ساخته شده است.

۳- در DNA خطی گروه …………………………………………………………. در یک انتها و گروه …………………………………………………………….. در انتهای دیگر آزاد است.

۴- در آزمایش چهارم گریفیت در خون و ……………………………………………………… موش های مرده، مقدار ……………………………………………………….. باکتری پوشینه دار ………………………………………………………………. مشاهده شد.

۵- در ساختار ریبوزومها علاوه بر ……………….. ……………… ریبوزومی نیز شرکت دارد.

۶- باز C دارای یک حلقه …………………………………………………… ضلعی است.

۷- ایوری و همکارانش مخلوط باکتری پوشینه دار کشته شده و فاقد پوشینه را در یک …………………………………. با سرعت قرار دادند.

۸- اگر در دیوکسی ریبوز ۳ عامل هیدروکسیل وجود داشته باشد در ریبوز ……………………………………………………………… عامل OH وجود دارد.

۹- در DNA نوکلئوتیدها با پیوند ………………………………………… به هم متصل و رشته های …………………………………… را می سازند.

ب) در جدول زیر، هر یک از گزاره ها با یکی از واژه ها ارتباط منطقی دارد. شماره واژه مرتبط را در جلوی گزاره صحیح بنویسید. (توجه: یک واژه اضافی است.)

واژه

۱- گریفیت ۲- ایوری ۳- چار گاف ۴- واتسون ۵- پرتو X

گزاره

الف) کشف DNA به عنوان عامل مؤثر در انتقال صفات ب) ارائه مدل مارپیچ دورشتهای DNA

پ) مادۂ وراثتی می تواند بین یاخته ها منتقل شود. ت) برابر بودن تعداد بازهای A و T

پ) در جدول زیر، هر یک از گزاره ها با یکی از واژه ها ارتباط منطقی دارد. شماره واژه مرتبط را جلوی گزاره صحیح ان بنویسید. (توجه: یک واژه اضافی است.)

گزاره

۱- DNA حلقوی ٢- پرتو ایکس ۳-گریفیت ۴- RNA پیک ۵- RNA ناقل ۶- RNA ریبوزومی

واژه

الف) کشف حالت مارپیچی DNA ب) اطلاعات اولیه در مورد ماده وراثتی پ) اطلاعات را از DNA به ریبوزوم می رساند. ت) فاقد دو انتهای آزاد ث) آمینواسید را به ریبوزوم می برد.

ت) درستی یا نادرستی جملات زیر را مشخص کنید. (در جملات نادرست، زیر عبارتهای غلط خط کشیده و درست آنها را بنویسید.)

۱۲- در آزمایشات گریفیت چگونگی انتقال مادۂ وراثتی مشخص شد.

۱۳- در زمان ایوری، برخی دانشمندان بر این عقیده بودند که پروتئین ها، مادۂ وراثتی هستند.

۱۴- مقدار گوانین موجود در mRNA همیشه با مقدار سیتوزین برابر است.

۱۵- در DNA دو باز تک حلقه ای در مقابل یک باز دوحلقه ای قرار می گیرد.

۱۶- در آزمایشات چار گاف دلیل برابری نوکلئوتید A با T در DNA طبیعی مشخص شد.

۱۷- در دو رشته یک مولکول DNA تعداد نوکلئوتیدها برابر است ولی نوع آنها یکسان نیست.

۱۸- در ساختار DNA همانند ژن، ۴ نوع نوکلئوتید وجود دارد.

۱۹- با استفاده از تصویر به دست آمده از پرتو X، ابعاد مولکول DNA مشخص شد.

۲۰- در ساختار ATP باز آدنین از حلقه کوچک تر خود به قند ۵ کربنه متصل می شود.

۲۱– با توجه به شکل به پرسش های زیر پاسخ دهید.

الف) موارد شماره گذاری شده را نام گذاری کنید.

ب) اختلاف RNA و DNA در کدام شماره ها است؟

پ) شماره ۴ آدنین است یا سیتوزین؟

ت) به جای شماره ۵، کدام عنصر قرار می گیرد؟

۲۲- با توجه به شکل به پرسش های زیر پاسخ دهید.

الف) موارد شماره گذاری شده را نام گذاری کنید.

۱-………………….

۲-………………….

۳-………………….

۴-………………….

۵-…………………..

۶-…………………..

۷-…………………..

۸-…………………..

ب) هر یک از شکل های (الف) و (ب) نشان دهنده کدام نوع از نوکلئیک اسیدها است؟

پ) در کدام مولکول A = T می باشد؟

ث) به پرسش های زیر پاسخ کوتاه دهید.

۲۳- اگر ترتیب رشته پلینوکلئوتیدی به صورت TGTGCAGAATGGC باشد، توالی رشته مقابل آن را بنویسید.

۲۴- در ساختار کروموزوم X کدام دو پلیمر مشارکت دارند؟

۲۵- عامل بیماری سینه پهلو کدام است؟

۲۶- نتیجه آزمایش سوم گریفیت چه بود؟

۲۷- ایوری و همکارانش ابتدا، در عصاره استخراج شده باکتریهای کشته شده پوشینه دار، کدام مولکول را تخریب کردند؟

۲۸- قند موجود در DNA چه نام دارد و چند کربنه است؟

۲۹- کدام اجزا از یک نوکلئوتید فاقد نیتروژن است؟

۳۰- پیوند بین قند و گروه فسفات در یک نوکلئوتید از چه نوعی است؟

۳۱- پیوندهای اشتراکی در یک نوکلئوتید، بین چه مولکول هایی است؟

به پرسش های زیر پاسخ کامل دهید.

۳۲- تفاوت نوکلئوتیدها در چیست؟

۳۳- ژن را تعریف کنید.

۳۴- نکات کلیدی مد نظر مدل مارپیچ دو رشته ای DNA را شرح دهید.

۳۵- انواع RNA را نام ببرید و نقش هر کدام را بنویسید.

۳۶- دو مورد از نتایج جفت شدن بازهای مکمل را شرح دهید.

را بنویسید.

۳۷- اگر توالی مولکول DNAی فرضی (AACAGCGTAالگو) و (TTGTCGCAT غیر الگو) باشد.توالی مولکول tRNA ای که از روی این مولکول رونویسی می شود را بنویسید.

۳۸-نقش های نوکلوئتید در یاخته را بنویسید.

۳۹- سه تفاوت بین DNA و RNA را بنویسید.

۴۰-ثابت بودن قطر DNA چه مزیتی دارد؟

۴۱- نقش پیوند هیدروژنی در DNA چیست؟

۴۲- چرا دانشمندان در ابتدا ، انتظار داشتند که ۴ نوع یاز در DNAیتمامی جانداران یکسان است؟

همواره نمونه سوالات ، دانش آموزان را برای ارائۀ بهتر درس پخته تر می کند. دانش آموزان با دیدن نمونه سوالات امتحانی ، دید بازتری نسبت به درس پیدا خواهند کرد. بدیهی است که هر چه تجربه بیشتر شود تبهر در کارها از جمله شاگرد اول شدن هم به مراتب بالا خواهد رفت . دوستان ، نمونه سوالات را از دست ندهید و خیلی البته ، خلاقیت خودتان را نیز فراموش نکنید و در پی کشف سوالات جدید از متن درستان باشید. مثال ورزشکاران که یاخته های ماهیچه یشان را تقویت می کنند ، شما هم یاخته های عصبی مغزتان را پرورش دهید.

فصل۲ جریان اطلاعات در یاخته

بارم ) نوبت اول : ۵ نمرهخرداد: ۲٫۵ نمرهشهریور: ۲٫۵نمره – دی ماه :۲٫۵٫

جریان اطلاعات در یاخته

علت بیماری کم خونی داسی شکل چیست؟

۱- درستی و نادرستی هر یک از عبارت های زیر را مشخص کنید.

آ)تعداد رمزه ها در RNAهای پیک تمامی جانداران یکسان است.

الف) هررمز سه نوکلئوتیدی mRNA رایک آنتی کدون(پادرمزه) می نامند .

ب) مناطقی از DNA که رونوشت آنها در mRNA ی بالغ باقی می ماند، میانه(اینترون) نامیده می شود.

پ) حذف رونوشت میانه(اینترون) ها و تشکیل mRNA بالغ در هسته صورت می گیرد.

پ)در فرایند ترجمه، هر دو نوع واکنش آبکافت و سنتز آبدهی انجام می شود.

ت) در محل اتصال آمینواسید به مولکول tRNA توالی CAC وجود دارد.

ث) پس از اتصال بخش بزرگ و کوچک ریبوزوم به یکدیگر، tRNA آغازگر با کدون آغاز رابطۀ مکملی برقرار می کند.

ح) مناطقی از DNA که رونوشت آنها در RNA بالغ باقی می ماند ، بیانه(اگزون) نامیده می شود.

ج)در بخش پادرمزه(آنتی کدون) مولکول tRNA ، توالی AUC نمی تواند وجود داشته باشد.

چ)ژنها به واسطه پروتئین ها می توانند صفات را ایجاد کنند.

۲ – در جملات زیر جاهای خالی را با کلمات مناسب پر کنید.

الف) ژن هایی که محصول رونویسی آنها ……………………. باشد ترجمه می شود.

ب) توالی های نوکلئوتیدی .. ………….. تعیین می کند که کدام …………………………… باید در ساختار پروتئین قرار بگیرد.

پ) یک تغییر ژنی باعث می شود پروتئین ……….. در گویچه قرمز دچار تغییر شده و در نتیجه شکل گویچه قرمز به صورت …………

ت) رمزه آغاز باعث آغاز ……………………………. می شود و معرف اسید آمینه …………………………………….. است.

ث) مواد اولیه مصرفی در ترجمه، …………… هستند و هم چنین …………….. و …………… از دیگر عوامل لازم در ترجمه هستند.

ح) پروتئین های ساخته شده از طریق فرایند ………………… به خارج یاخته رفته و یا ممکن است در ……………… باقی بمانند.

۳- پرسش های چند گزینه ای:

آ)کدام نادرست است؟ «در باکتری اشرشیاکلای، رونوشت …………………………………..

۱) ژن مهار کننده، ترجمه می شود ۲) جایگاه پایان رونویسی، قند دئوکسی ریبوز دارد

۳) رمز؛ پایان، ترجمه نمی شود ۴) بخش قرار گرفته قبل از ژنهای تجزیه کننده لاکتوز، باز آلى آدنین دارد.

ب) در صورت تجزیه باکتریهای همراه غذا در لوله گوارشی انسان، از کدام یک نمی تواند آمونیاک به وجود آید؟

۱) اپراتور ۲) عوامل پایان ترجمه ۳)عوامل رونویسی ۴)عامل تغییر شکل دهنده مهار کننده

پ)کدام عبارت درباره تنظیم بیان (رونویسی ژن های مربوط به تجزیه لاکتوز در اشرشیاکلای درست است؟

۱) توالی واحدهای سازنده لاکتوز، توسط ژن سازنده مهار کننده در باکتری تعیین می گردد.

۲) در حضور لاکتوز، پروتئین مهار کننده تغییر شکل یافته و به توالی اپراتور متصل می شود.

۳) اتصال لاکتوز به مهار کننده باعث تجزیه مهار کننده و شروع رونویسی می گردد.

۴) در پی اتصال لاکتوز به مهار کننده، گلوکز بیشتری در اختیار یاخته قرار می گیرد.

۴- به پرسش های زیر در مورد تنظیم بیان ژنها پاسخ دهید:

الف ) بخش تنظیم کنندهی رونویسی منفی در اشرشیا کلای شامل چه بخش هایی است؟ نام ببرید.

ب) توالی افزاینده در کدام نوع سلولها وجود دارد و نقش آن چیست؟

۵- مرحلۀ طویل شدن ترجمه چگونه شروع می شود؟

۶- دو مورد از تفاوت های فرایند همانندسازی و رونویسی را بنویسید.

۷- در مورد انواع مولکول RNA به سؤالات زیر پاسخ دهید:

الف ) با توجه به این نکته که مولکول tRNA تک رشته ای است، بخش های دو رشته ای موجود در مولکول tRNA چگونه حاصل شده است ؟

ب) کدون(رمزه) اولین آمینو اسید در هر زنجیره پلی پپتیدی بر روی mRNA چیست ؟

۸- در مورد تنظیم بیان ژن در پروکاریوت ها و یوکاریوت ها به سؤالات پاسخ دهید.

الف) عمدتا تنظیم بیان ژن پروکاریوت ها چه هنگام صورت می گیرد؟

ب ) مولکول پروتئینی که شناسایی راه انداز را در یوکاریوت ها انجام می دهند، چه نام دارند؟

۹- در جریان بالغ شدن یک mRNA اولیه چهار پیوند فسفو دی استر شکسته می شود:

الف)mRNA حاصل چند بیانه( اگزون ) دارد؟

ب) در این فرآیند چند پیوند فسفو دی استر تشکیل می شود؟

۱۰- در مورد tRNA به سؤالات زیر پاسخ دهید.

الف) در tRNAحامل آمینو اسید متیونین، جایگاه اتصال آمینو اسید دارای کدام توالی می باشد؟

ب ) توالی مزبور چه نام دارد؟

۱۱- به سؤالات زیر در مورد تنظیم بیان ژن پاسخ دهید.

الف) اتصال کدام ماده به پروتئین مهار کننده، در تنضیم منفی رونویسی باعث روشن شدن ژن می شود؟

ب) تنظیم بیان ژن در یوکاریوت ها غالبا در چه هنگامی انجام می گیرد؟

۱۲- رشته mRNA حاصل از DNA الگو مقابل، تحت تأثیر یکی از انواع جهش های نقطه ای قرار گرفته است. رشته DNA الگو TACACACGTATT: و رشته mRNA جهش یافته: AUGUGGCAUAA

الف) با توجه به رشته DNA الگو ،رشته رمزینه را بنویسید.

؟ ب ) کدام نوکلئوتید در رشته DNA مورد جهش قرار گرفته است ؟

۱۳- در ارتباط با توالی نوکلئوتیدی درmRNA زیر به سؤالات پاسخ دهید:

mRNA: AAAGUAAUGUUUCGUUGA

الف) اولین پادرمزه که وارد جایگاه A ریبوزوم(رناتن) می شود، کدام است؟

ب) آخرین رمزه که در جایگاه P ریبوزوم قرار می گیرد، کدام است؟

ج) کدون پایان در کدام جایگاه ریبوزوم قرار می گیرد؟

۱۴- در فرآیند ترجمه کدام یک زودتر رخ می دهد؟ (الف یاب).

الف) رناتن(ریبوزوم) به اندازه یک کدون در طول mRNA به پیش می رود.

ب) tRNA حامل دومین آمینواسید به جایگاه A وارد می شود.

۱۵ – در رابطه با بیماری کم خونی داسی شکل به سؤالات زیر پاسخ دهید:

الف) علت این بیماری چیست؟

ب) این بیماری نشان دهنده رابطه بین کدام مولکولها در یاخته است؟

۱۶- نقش هر یک از دو نوع آنزیم RNA پلی مراز او RNA پلی مراز II را در سلول های یوکاریوتی بنویسید.

همواره نمونه سوالات ، دانش آموزان را برای ارائۀ بهتر درس پخته تر می کند. دانش آموزان با دیدن نمونه سوالات امتحانی ، دید بازتری نسبت به درس پیدا خواهند کرد. بدیهی است که هر چه تجربه بیشتر شود تبهر در کارها از جمله شاگرد اول شدن هم به مراتب بالا خواهد رفت . دوستان ، نمونه سوالات را از دست ندهید و خیلی البته ، خلاقیت خودتان را نیز فراموش نکنید و در پی کشف سوالات جدید از متن درستان باشید. مثال ورزشکاران که یاخته های ماهیچه یشان را تقویت می کنند ، شما هم یاخته های عصبی مغزتان را پرورش دهید.

فصل۳ انتقال اطلاعات در نسل ها

بارم ) نوبت اول : ۴ نمرهخرداد: ۲٫۵ نمرهشهریور: ۲٫۵نمره – دی ماه : ۲٫۵ .

انتقال اطلاعات در نسل ها

آ) درستی یا نادرستی هر یک از عبارتهای زیررا مشخص کنید.

  1. ویژگیهای والدین توسط دستورالعمل هایی که در پروتئین های موجود در گامت ها قرار دارد به نسل بعد منتقل می شود.
  2. ساختار و عمل DNA قبل از کشف قوانین وراثت توسط مندل، مشخص شده بود.
  3. تمامی صفات فرزندان از طریق وراثت از والدین به آنها به ارث رسیده است.
  4. اگر پروتئین D روی غشاء گویچه های قرمز باشد ،گروه خونی RH مثبت است.
  5. الل های مختلف مربوط به یک ژن روی جایگاه های مشابهی از کروموزومهای همتا قرار دارند.
  6. در گل میمونی با دیدن رنگ گل می توان ژنوتیپ آن را تشخیص داد.
  7. گروه خونی DD مثبت و گروه خونی Dd ، منفی است.
  8. دو دگره(الل) برای رنگ گل میمونی وجود دارد که یکی قرمز و دیگری سفید است.
  9. برای یک صفت خاص هیچ گاه انواع فنوتیپ از انواع ژنوتیپ کم تر نیست.
  10. برای گروه خونی ABO چهار نوع ژنوتیپ و چهار نوع فنوتیپ وجود دارد.
  11. هموفیلی یک بیماری وابسته به جنس و بارز است.
  12. رخ نمود صفات تک جایگاهی، غیرپیوسته است.
  13. علائم بیماری PKU از زمان تولد آشکار می شود.
  14. برای صفت گروه خونی ABO در یک شخص می تواند، بیش از دو نوع الل هم وجود داشته باشد.
  15. هر صفت چنداللی حتما صفتی پیوسته است.

ب) جاهای خالی را با کلمات مناسب پر کنید.

  1. بیش ازکشف قوانین وراثت ، توسط …………………. تصور بر این بود که صفات فرزندان…………. از صفات والدین و ………………………… از آن هاست.
  2. گروه خونی Rh براساس بودن یا نبودن نوعی ……………….. است که در غشای……………. جای دارد و…………………… نامیده میشود.
  3. جایگاه ژنهای گروه خونی Rh بر روی کروموزوم شماره ……………………………. و جایگاه ژنهای گروه خونی ABO بر روی کروموزوم شماره ……………………..قرار دارد.
  4. به شکل های مختلف ژنهای مربوط به یک صفت که ……………….. یکسانی دارند…………………………. می گویند.
  5. هموفیلی یک بیماری ……………….. است و الل مربوط به این بیماری روی کروموزوم……………………… قرار دارد.
  6. صفات ………………. فنوتیپ …………………………دارند و نمودار توزیع فراوانی آنها شبیه زنگوله است.
  7. صفاتی که بدون طیف هستند صفات ……………….. نام دارند و حتما …………………….. هستند.
  8. بیماری فنیل کتونوری در اثر فقدان آنزیم …………… آمینواسید فنیل آلانین به وجود می آیدو…………………. فنیل آلانین به ایجاد ترکیبات خطرناک منجر می شود.

پ) مردی با گروه خونی A با زنی با گروه خونی B که هر دو دارای ژنوتیپ ناخالص هستند، ازدواج می کند.

  1. انواع فنوتیپهای جدید احتمالی در فرزندان کدامند؟
  2. احتمال تولد فرزندی با گروه خونی A چقدر است ؟

ت) هر یک از صفات زیر از کدام الگوی ورانتی تبعیت می کند؟

  1. رنگ موهای اسب
  2. ب) حالت موی انسان

ث) مسائل ژنتیکی

  1. اگر گروه خون پدر+ A و گروه خون مادر+ B و اولین فرزند آنها دختری با گروه خونO- باشد، چه قدر احتمال دارد دومین فرزند آنهاپسری با گروه خون A- باشد؟
  2. در بررسی همزمان دو صفت گروه خونی Rh و گروه خونی ABO چند نوع ژنوتیپ و چند نوع فنوتیپ قابل تصور است؟
  3. اگر فرزند اول و دوم یک خانواده به ترتیب گروه خون O و AB داشته باشند چه قدر احتمال دارد فرزند سوم این خانواده پسری با گروه خونی B باشد؟
  4. اگر مردی هموفیل با زنی ناقل هموفیلی ازدواج کند، چه قدر احتمال دارد اولین پسر آنها مبتلا به هموفیلی باشد؟

ج) به سوالات زیر پاسخ دهید.

  1. ژن شناسی چه شاخه ای از زیست شناسی است؟
  2. صفات تک جایگاهی و صفات چندجایگاهی را تعریف کنید.
  3. انواع ژنوتیپ های احتمالی برای فردی که گروه خون B دارد را بنویسید.
  4. در چه حالتهایی می توان با دیدن فنوتیپ، ژنوتیپ را تشخیص داد؟
  5. در چه صورتی فرزندان تمام ژن های خود را از یک والد دریافت می کنند؟
  6. مثبت یا منفی بودن گروه خون به چه چیزی بستگی دارد؟
  7. در چه صورتی فرزندان تمام ژن های خود را از یک والد دریافت می کنند؟
  8. اگر گروه خون مادر مثبت و گروه خون فرزندش منفی باشد، ژنوتیپ مادر خالص است یا ناخالص؟

فصل ۴ تغییر در اطلاعات وراثتی

بارم ) نوبت اول : ۵ نمرهخرداد: ۲٫۵ نمرهشهریور: ۲٫۵نمره – دی ماه : ۲٫۵٫


جاهای خالی را با کلمات مناسب پر کنید.

  • ماده وراثتی باید به طور ………….. تغییرپذیر باشد. این تغییر پذیری زمینه ………………. را فراهم می کند.
  • قرار گرفتن نوکلئوتید ……………………. به جای نوکلئوتید A در ژن …………………… باعث ایجاد بیماری کم خونی ناشی از گلبول های قرمز………….. می شود.
  • جهشی که باعث بیماری کم خونی ناشی از گلبول های قرمز می شود، جهشی……… از نوع…………… است.
  • تغییر در تعداد کروموزوم ها را ناهنجاری ……….. در کروموزومها می نامند. مانند مبتلایان به بیماری…………
  • اگر جهت قرارگیری بخشی از کروموزوم در جای خود تغییر کند به آن جهش…………………….. می گویند که نوعی از ناهنجاریهای …….
  • ژنگان سیتوپلاسمی در گیاهان شامل دنای ………………………. و ……………………………….. است.
  • بنزوپیرن از عوامل جهش زای …………………………………. است که در …………………………………… وجود دارد.
  • اگر جهش در بخش تنظیمی ژن رخ دهد بر ……………………. پروتئین اثر ندارد بلکه بر …………………… آن پروتئین اثر می گذارد.
  • در جدول زیر، هر یک از گزاره ها با یکی از واژه ها ارتباط منطقی دارد. شماره واژه مرتبط را داخل الابنویسید. (توجه: یک واژه اضافی است.)
ردیفواژهگزارهشمارۀ وازۀ مرتبط
۱واژگونیکل محتوای مادۂ وراثتی یک یاخته 
۲مضاعف شدنبخشی از یک کروموزوم به نقطه دیگری از همان کروموزوم منتقل می شود 
۳جابه جاییکل محتوای مادۂ وراثتی در یک مجموعه کروموزوم 
۴ژنگانجهشی که در یاخته هاپلویید رخ نمی دهد 
۵ژنگان سیتوپلاسمیجهت قرار گیری بخشی از کروموزوم در جای خود تغییر می کند 
۶ژنگان هسته ای  

درستی یا نادرستی جملات زیر را مشخص کنید.

  • تغییر پذیری مادۀ وراثتی توانایی بقای فرد را در شرایط متغییر محیط افزایش می دهد.
  • تعداد آمینواسیدهای هموگلوبین فرد مبتلا به کم خونی ناشی از گویچه های قرمز داسی شکل با آمینواسید های هموگلوبین فرد سالم برابر است.
  • اگر در تغییر در مادۀ وراثتی اندک باشد پیامد های آن نیز اندک است.
  • هرنوع تغییر در مادۀ وراثتی جهش محسوب می شود.
  • جهش جانشینی می تواند باعث تغییر یول دنا و پروتئین شود.
  • جهش حذفی واضافه ممکن است باعث تغییر در چارچوب خواندن نشود.
  • جهش مضاعف شدن نمی تواند در یاخته های پیکری زنبور عسل نر رخ دهد.
  • جهش می تواند باعث افزایش مقدار محصول ژن شود.
  • جهش حذف و اضافه هر چه به ابتدای ژن نزدیکتر باشد.باعث اثرات منفی بیشتری در چارچوب خواندن می شود.
  • در بیماری کم خونی ناشی از گلبول های قرمز داسی شکل فقط یک نوکلئوتید در ساختار دنا تغییر می کند.

به پرسش های زیر پاسخ کوتاه دهید.

  • هر یک از موارد زیر به چه نوع جهشی اشاره می کند.

الف) قسمتی از یک کروموزوم به کروموزوم غیر همتای آن منتقل می شود.

ب)بخشی از یک کروموزوم به کروموزوم همتای آن منتقل می شود.

پ)چند نوکلئوتید به دنا افزوده می شود.

ت)جهشی که تاثیری بر پروتئین نخواهد داشت.

  • جهش در چه بخشی از ژن می تواند بر مقدار ساخت پروتئین موثر باشد؟
  • ژنگان هسته ای انسان شامل چند کروموزوم است؟
  • کدام نوع جهش باعث ابجاد افراد مبتلا به داون میشود.
  • کدام نوع جهش باعث ایجاد بیماری گلبول های قرمز داسی شکل می شود.
  • چگونه می توان از وجود ناهنجاری های کروموزومی آگاه شد؟
  • در چه صورتی جهش جانشینی بی تاثیر است؟
  • به پرسش های زیر پاسخ کامل دهید.
  • هریک از انواع جهش های زیر را تعریف کنید.

الف)حذف:

ب)واژگونی:

پ)مضاعف شدگی:

ت)جابجایی:

  • درچه صورتی جهش حذف و اضافه باعث تغییر در چارچوب خواندن نمی شود؟
  • تفاوت ناهنجاری های ساختاری و ناهنجاری های عددی کروموزوم چیست؟
  • به نظر شما تغییر در ساختار دنا اثرات طولانی مدت تری دارد یا تغییر مستقیم در رنا ،چرا؟
  • در چه صورتی جهش در یاخته های پیکری یک جاندار می تواند به فرزندان منتقل شود؟
  • اگر جانداری فقط یک کروموزوم داشته باشد آیا می تواند دچار جهش جابه جایی شود؟ چرا؟
  • در چه صورتی میزان تولید یک پروتئین در اثر جهش افزایش می یابد؟
  • آیا جهش در ژن مربوط به یک آنزیم می تواند در میزان تولید سایر آنزیم ها هم مؤثر باشد؟ توضیح دهید.
  • جهش اضافه شدن چگونه می تواند باعث افزایش یا کاهش طول یک رشته پلی پپتیدی شود؟
  • در جهش جانشینی به علت …………….. جانشینی در یک نوکلئوتید به جانشینی در یک جفت نوکلئوتید منجر می شود.

۱) وجود پیوند فسفودی استر بین نوکلئوتیدها ۲) وجود رابطه مکملی بین بازها

  • خطاهایی که هنگام همانندسازی دنا رخ می دهند ………………………… باعث جهش می شوند.

۱) حتما ۲ ) احتمالا

  • اگر جهش در راه انداز ژن رخ دهد ……………………….. را تغییر دهد.

۱) نمی تواند مقدار تولید پروتئین ۲) نمی تواند شکل جایگاه فعال آنزیم

  • جهش های کروموزومی حذفی ……………………………….. باعث مرگ می شوند.

۱) غالبه ۲) ندرت

  • تشکیل پیوند بین دو تیمین مجاور هم که در پار تیمین نام دارد تحت تأثیر……………………. که یک عامل جهش زای ………….. صورت می گیرد

۱) بنزوپیرن / شیمیایی ۲) پرتو فرابنفش / فیزیکی

  • ژنگان هسته ای در انسان، عبارت است از ……………

۱) ۲۳ کروموزوم غیرجنسی و یک کروموزوم جنسی ۲) ۲۲ کروموزوم غیر جنسی و دو کروموزوم جنسی

  • چند جمله زیر در مورد ماده وراثتی انسان درست است؟

الف) تعداد کروموزوم های تشکیل دهنده ماده وراثتی در زن و مرد برابر است.

ب) متابولیسم مواد وراثتی میزان اوریک اسید خون را افزایش می دهد.

پ) ماده وراثتی انسان می تواند مولکولی دو رشته ای نباشد.

ت) هر نوع تغییر در ماده وراثتی جهش محسوب می شود.

۱)۱ ۲)۲ ۳)۳ ۴)۴

  • چند جمله عبارت زیر را به درستی تکمیل می کند؟

در افراد مبتلا به کم خونی ناشی از گلبول های قرمز داسی شکل …………..

الف) تعداد آمینواسیدهای تشکیل دهنده هموگلوبین نسبت به یک فرد سالم متفاوت است

ب) میزان هموگلوبین کاهش می یابد

پ) سه آمینواسید متفاوت نسبت به افراد سالم در هموگلوبین خود دارند

ت) همه روش های حمل اکسیژن در خون کاهش نمی یابد

۱)۱ ۲)۲ ۳)۳ ۴)۴

  • کدام یک از جملات زیر همواره درست است.

الف) تغییر پایداری در هر اسید نوکلئوئیک جهش محسوب می شود.

ب)جهش باعث به وجود آمدن نوعی پروتئین غییر طبیعی می شود.

پ)جهش جانشینی باعث جانشینی در یک جفت نوکلئوتید می شود.

ت) در جهش های کوچک تعداد کروموزوم ها تغییر نمی کند.

۱)الف و ت ۲) پ و ت ۳) ب وپ ۴) الف و ب

  • کدام یک از جهش های زیر نمی تواند در یاخته ای با عدد کروموزومی ۴=n رخ دهد؟

۱)ناهنجاری عددی ۲) مضاعف شدن ۳)واژگونی ۴) جابجایی

  • نشانگان داون …………………………

۱) نوعی ناهنجاری ساختاری کروموزومی است که باعث تغییر در چارچوب خواندن نمی شود.

۲)نوعی جهش مضاعف شدن است که باعث تغییر در چارچوب نمی شود.

۳)نوعی ناهنجاری عددی است که باعث تغییر در چارچوب می شود.

۴)نوعی ناهنجاری عددی است که باعث تغییر در چارچوب خواندن نمی شود.

  • کدام یک از جملات زیر در مورد آنزیم ها نادرست است؟

۱) هر نوع تغییر در ساختار آنزیم ها نتیجۀ جهش است ۲) هر نوع تغییر در ساختار آنزیم ها باعث تغییر عملکرد آن می شود.

۳)واحد سازندل آنزیم می تواند مشابه واحد سازندۀ هموگلوبین نباشد. ۴)برای ساختن هرآنزیم باید فرایند ترجمه طی شود.

  • چند مورد از جملات زیر درست است؟

الف)در یاخته های پیکری هر زنبور عسل احتمال وقوع جهش واژگونی وجود ندارد.

ب) تغییر در دنای یاخته های پیکری ممکن است به نسل بعد منتقل شود.

پ)جهش ممکن است هیچ تغییر یدر میزان و ساختار پروتئین ایجاد نکند.

ت)در هیچ موجود زنده ای مولکول جهش یافتۀ تک رشتهای نیست.

۱)۱ ۲)۲ ۳)۳ ۴)۴

  • هرمولکول جهش یافته …………….

۱)از یکی از والدین به ارث رسیده است.

۲)دارای ۵۰% یاز پورینی است.

۳)ممکن است تحت تاثیر پرتو فرابنفش که یک عامل جهش زای شیمیایی است به وجود آمده باشد.

۴)اثری روی فنوتیپ جاندار دارد.

  • کدام یک از جملات زیر در رابطه با انواع جهش ها درست است؟

۱)در جهش مضاعف شدن برخی از کروموزوم ها فاقد برخی از ژن ها هستند.

۲)جهش جانشینی می تواند باعث تغییر در چارچوب شود.

۳)در هر انسان جهش مضاعف شدن می تواند در مورد ۲۳ جفت کروموزوم رخ دهد.

۴)جهش مضاعف شدن می تواند باعث افزایش تعداد کروموزوم ها شود.

  • چند مورد در رابطه با گیاهان درست است؟

الف) جهش در هریک از اسپرم های گیاهان نهاندانه به نسل بعد منتقل می شود.

ب)در یاختۀ تخم ضمیمۀ گیاهان جهش مضاعف شدن نمی تواند رخ دهد.

پ)جهش در یاختۀ رویشی دانۀ گرده قطعاً به نسل بعد منتقل نمی شود.

ت) جهش در یاخته های ساقه یک گیاه ممکن است به نسل بعد منتقل شود.

۱)۱ ۲)۲ ۳)۳ ۴)۴

  • ساختار کدام یک از موارد زیر تحت تأثیر مستقیم عوامل جهش زا قرار نمی گیرد؟

۱) راه انداز و آنتی کدون ۲) توالی افزاینده و عوامل رونویسی

۳) اگزون و اینترون ۴) فعال کننده و مهار کننده

  • کدام گزینه نادرست است؟

۱) هر چه تعداد کروموزوم پایین تر باشد احتمال جهش هم بیشتر میشود.

۲) احتمال کراسینگاور در کروموزوم ۲ بیشتر از کروموزوم ۱۵ است

۳) جهش در یاخته پیکری یک جاندار نمی تواند باعث ایجاد تومور در فرزندان شود.

۴) مولکولی که دچار جهش میشود قطعأ فاقد باز آلی یوراسیل است.

  • هر جهش …………………………….. است.

۱) کوچک، نوعی جهش جانشینی ۲) جانشینی، بر مولکولهای حاصل از رونویسی بی تأثیر

۳) کوچک بر بیان ژن تأثیرگذار ۴) تغییر در چارچوب، نوعی جهش کوچک

  • در کدام یک از جهش های زیر طول هیچ کروموزومی قطعا تغییر نمی کند؟

۱) مضاعف شدن ۲) جابه جایی ۳) واژگونی ۴) حذف

  • چند مورد عبارت زیر را به درستی تکمیل می نماید؟

در جانوران هر نوع …………………………..

الف) تبادل قطعه بین دو کروموزوم جهش نام دارد

ب) تغییری در عدد کروموزومی جهش محسوب می شود

پ) جهش جانشینی باعث تغییر در توالی آمینواسیدها نمی شود

ت) جهشی باعث تغییر در ماده ژنتیک می شود

۱)۱ ۲)۲ ۳)۳ ۴)۴

جاهای خالی را با کلمات مناسب پر کنیید.

  • مطلوب یا نامطلوب بودن یک ویژگی را، …………………………………………….. تعیین می کند.
  • فرایندی که در آن افراد ………………………….. با محیط انتخاب می شوند…………………………. نامیده میشود.
  • به مجموعه افرادی که به یک ………………….. تعلق دارند و در یک محل زندگی می کنند ……… می گویند.
  • در فرایند رانش اللى، ………………………… اللها (دگره ها در اثر ……………………………….. تغییر می کند.
  • انتخاب طبیعی در نهایت باعث ……………….. جانداران با ……………………………… می شود.
  • این که هر گامت کدام یک از کروموزوم ها را دریافت می کند به ……………….. در مرحله…………….. میوز۱ بستگی دارد.
  • به تبادل قطعه بین کروموزومهای همتا در تقسیم میوز …………… گفته می شود که در مرحله……….. رخ می دهد.
  • نوعی بیماری خونی که میزان بیلی روبین خون افزایش می یابد، توسط انگل …… که در …………….. زندگی می کند ایجاد می شود.
  • اگر ……………….. اللها در نسل های بعدی هم حفظ شود، گفته می شود که جمعیت در…………… است.
  • در جدول زیر، هر یک از گزاره ها با یکی از واژه ها ارتباط منطقی دارد.
ردیفواژهگزارهشمارۀ وازۀ مرتبط
۱شارش ژنتغییر در جمعیت برای تطابق بیشتر با محیط 
۲رانش اللیکاهش فراوانی برخی الل ها به صورت تصادفی 
۳سازشافراد مبتلا به گلبول های قرمز داسی شکل در مناطق مالاریاخیز 
۴کراسینگ اورپدیده ای که مترادف با مهاجرت است. 
۵انتخاب طبیعیکاهش فراوانی الل های نامطلوب به صورت غیرتصادفی 
۶برتری ناخالص ها  

درستی یا نادرستی جملات زیر را مشخص کنید. (در جملات نادرست، زیر عبارت های غلط خط کشیده و درست آنها را بنویسید.)

  • مقاوم شدن باکتری ها به آنتی بیوتیک (پادزیست) نشان دهنده تغییر موجود زنده در طول زندگی است.
  • هر چه تفاوت های فردی در یک گونه کمتر باشد پایداری آن گونه بیشتر می شود.
  • تغییر شرایط محیطی می تواند باعث تبدیل صفات مطلوب به صفات نامطلوب شود.
  • فرایند انتخاب طبیعی باعث تغییر فرد در طول زندگی می شود.
  • برای آن که جمعیتی در حال تعادل باشد باید تعداد اللها در نسل های متوالی ثابت بماند.
  • با افزایش اندازه جمعیت، اثرات رانش اللی شدیدتر می شود.
  • شارش ژن می تواند تنوع الل ها را در جمعیت مبدأ افزایش دهد.
  • هر فردی از جمعیت زنبور عسل با نوترکیبی گامت های متنوع ایجاد می کند.
  • ژنوتیپ به صورت غیرمستقیم و فنوتیپ به صورت مستقیم تحت تأثیر انتخاب طبیعی قرار می گیرند.

به پرسش های زیر پاسخ کوتاه دهید.

۷۴- چه عاملی تعیین می کند که کدام صفت به نسل بعد منتقل شود؟

۷۵- علت مقاوم شدن باکتری ها به پادزیست کدام پدیده است؟

۷۶- در چه صورتی جمعیت از تعادل خارج می شود؟

۷۷- کدام پدیده می تواند باعث حذف الل های سازگار از محیط شود؟

۷۸- این که کدام کروموزوم ها با هم در یک گامت یافت میشود به چه چیزی بستگی دارد؟

۷۹- فراوانی الل های گویچه های قرمز داسی شکل در چه محیطهایی بیشتر است؟

۸۰- حضور چه افرادی در مناطق مالاریاخیز باعث بقای جمعیت انسانها در این مناطق می شود؟

به پرسش های زیر پاسخ کامل دهید.

۸۱- جهش در چه صورتی تشخیص داده نمی شود؟

۸۲- افزایش تفاوت های فردی در یک گونه چگونه به پایداری آن کمک می کند؟

۸۳ – اصطلاحات زیر را تعریف کنید.

الف) جمعیت در حال تعادل ب) خزانه ژن

۸۴- چه عواملی می توانند باعث تغییر فراوانی اللها شوند؟

۸۵- آیا اثر رانش روی دو جمعیت مشابه یکسان است؟ چرا؟

۸۶- چه عواملی باعث می شود با وجود انتخاب طبیعی همچنان تنوع اللی در جمعیت حفظ شود؟

۸۷- در چه صورتی کراسینگ اور منجر به نوترکیبی نمی شود؟

۸۸- تفاوت شارش ژن و رانش اللی چیست؟

۸۹- با در نظر گرفتن کراسینگ اور بین یک جفت کروموزوم در یاخته زاینده یک زن هنگام میوز چند نوع گامت می تواند به وجود آورد؟

۹۰- چرا زیست شناسان از واژه «صفت بهتر» استفاده نمی کنند؟ واژه جایگزین کدام است؟

۹۱- چه رابطه ای بین بیماری مالاریا و فراوانی الل مربوط به گویچه های قرمز داسی شکل وجود دارد؟ چرا؟

۹۲- چرا مصرف زیاد سوسیس و کالباس می تواند باعث ایجاد سرطان شود؟

گزینۀ مناسب را انتخاب کنید.

۹۳- مجموع …………………………. را خزانه ژن می نامند. ,

۱) همه الل های موجود در همه جایگاههای ژنی افراد یک جمعیت ۲) فراوانی نسبی همه الل های موجود در جایگاه های ژنی یک جمعیت

۹۴- در اثر انتخاب طبیعی فراوانی افراد سازگار افزایش و …………

۱) فراوانی سایر افراد کاهش می یابد ۲) فراوانی سایر افراد ثابت باقی می ماند

۹۵ – این که هر گامت چند کروموزوم دریافت می کند به ……………………… بستگی دارد.

۱) آرایش تترادها در میوزا ۲) تعداد کروموزوم های یاخته های والدین

۹۶- در فرایند کراسینگ اور تبادل قطعه بین……………………. هنگام …………………….. صورت می گیرد.

۱) کروموزوم های همتا / تشکیل تتراد ۲) کروماتیدهای خواهری / متافازا

۹۷- در مناطق مالاریاخیز شانس بقای افراد ناخالص از نظر کم خونی داسی شکل ……………………… بیشتر است.

۱) از همه افراد خالص ۲) فقط از افراد خالص مغلوب

۹۸- در جانداران دیپلوئید، ……………باعث حفظ آلل های …………………..نامطلوب در جمعیت می شود.

۱) ناخالصها / مغلوب ۲) خالصها / غالب

۹۹- چند مورد از عبارات زیر نادرست نیست

الف) گونه هایی که به روش غیر جنسی تولید مثل می کنند نسبت به گونه هایی که تولید مثل جنسی دارند پایدارترند. ؟

ب) هر چه ژنوتیپ افراد یک گونه شباهت کمتری داشته باشد، آن گونه پایدارتر است.

پ) سازگار بودن صفت یک ویژگی نسبی است.

ت) افراد سازگارتر قطعه شانس بیشتری برای زاد و ولد دارند.

۱)۱ ۲)۲ ۳)۳ ۴)۴

۱۰۰- کدام جمله نادرست است؟ .

۱) افراد متعلق به یک جمعیت می توانند از چند گونه مختلف باشند.

۲) افراد یک گونه می توانند چند جمعیت مختلف داشته باشند.

۳) در یک محیط، چند جمعیت مختلف می توانند همزمان زندگی کنند.

۴) افراد متعلق به یک جمعیت دارای تفاوت ژنوتیپی هستند.

۱۰۱- اگر جمعیتی در حال تعادل نباشد …………

۱) تنوع اللها قطعا تغییر می کند

۲) درصد اللها قطعا تغییر می کند

۳) تعداد اللها قطعا تغییر می کند

۴) فراوانی نسبی اللها تغییری نمی کند

۱۰۲- کدام گزینه در مورد رانش اللی درست است؟

۱) رانش اللی ممکن است تغییری در اندازه جمعیت ایجاد نکند. ۲) رانش اللی در جمعیتهای مختلف اثرات مشابهی دارد.

۳) رانش اللی باعث سازش جانداران با محیط میشود. ۴) رانش اللی ممکن است باعث حذف الل های سازگارتر شود

۱۰۳ – انتخاب طبیعی …………….

۱) فراوانی الل ها را در خزانه ژن تغییر نمی دهد

۲) ممکن نیست باعث افزایش فراوانی افراد غیر سازگار نیز بشود

۳) در نهایت باعث سازش جمعیت با محیط میشود

۴) جمعیت را از تعادل خارج نمی کند

۱۰۴ – شارش ژن ……………………………………

۱) می تواند باعث افزایش تنوع اللی در جمعیت مقصد و مبدأ شود

۲) می تواند باعث کاهش تنوع اللی در جمعیت مقصد شود

۳) می تواند باعث افزایش تفاوتهای بین جمعیت مبدأ و مقصد شود

۴) می تواند باعث خروج جمعیت از تعادل شود

۱۰۵- گوناگونی اللی در گامتها ………………………………………

۱) مخصوص جاندارانی است که فقط تولیدمثل جنسی دارند

۲) می تواند در جاندارانی که تولیدمثل غیر جنسی دارند نیز رخ دهد

۳) همانند انتخاب طبیعی باعث حفظ تفاوت های فردی و گوناگونی می شود

۴) برخلاف انتخاب طبیعی، باعث کاهش تفاوت های فردی نمی شود

۱۰۶- اگر جانداری ۲n = X باشد، تعداد انواع آرایش تترادی در متافاز ۱ برابر است با …

۱)X

2)2X

3)X/2

4)X-1

۱۰۷- اگر جانداری ژنوتیپ باشد در صورت وقوع کراسینگ اور هنگام میوز چند نوع گامت می تواند تولید نماید؟

۱)۱ ۲)۲ ۳)۳ ۴)۴

۱۰۸- کراسینگ اور…………

۱) در جاندار هاپلویید هم می تواند رخ دهد ۲) قطعا تنوع گامت ها را افزایش میدهد

۳) می تواند باعث افزایش تفاوت های فردی در جمعیت شود ۴) فقط در جانداران دیپلوئید رخ می دهد

۱۰۹- چند مورد از عبارات زیر نادرست است؟

الف اللهای نامطلوب مغلوب زودتر از الل های نامطلوب، غالب از خزانه زن حذف می شوند.

ب) الل های مطلوب مغلوب زودتر از خزانه زن حذف می شوند

ب) الل های نامطلوب غالب دیرتر از خزانه ژن حذف می شوند

ت) الل های مطلوب غالب زودتر از خزانه ژن حذف می شوند.

۱)۱ ۲)۲ ۳)۳ ۴)۴

۱۱۰- در افرادی که برای گلبول های قرمز داسی شکل ژنوتیپ ناخالص دارند .

۱) شانس بقا و تولیدمثل همواره کمتر از افراد خالص غالب است

۲) شانس بقا و تولیدمثل همواره کمتر از افراد مغلوب است

۳) شانس بقا و تولیدمثل ممکن است بیشتر از افراد مغلوب باشد

۴) شانس بقا و تولیدمثل ممکن است بیشتر از افراد خالص غالب باشد

۱۱۱- رابطه عامل بیماری مالاریا با انسان همانند رابطه ……………………………… است.

(۱) ریزوبیوم با گیاه نخود ۲) گل جالیز با گوجه فرنگی ۳) سیانوباکتری با گیاه گونرا ۴) گیاه گوشت خوار با حشره

۱۱۲- در مناطقی که عارضه گلبول های قرمز داسی شکل شایع است شانس بقا و تولیدمثل………………. در هنگام شیوع مالاریا نسبت به قبل از آن ……………………………………..

۱) افراد ناخالص – بیشتر میشود ۲) خالص های مغلوب – کمتر می شود

۳) خالص های غالب و مغلوب – کمتر میشود ۴) خالص های مغلوب و ناخالص ها – تغییر نمی کند

۱۱۳ – از عوامل مؤثر در باقی ماندن جمعیت در حال تعادل این است که …………………………….

۱) انتخاب طبیعی رخ دهد ۲) برخی از افراد شانس بقای کمتری داشته باشند

۳) فراوانی اللها نسبتأ ثابت بماند ۴) مهاجرت به درون جمعیت صورت گیرد

۱۱۴- جهش ………………

۱) می تواند جهت و مقدار تغییر گونه ها را تعیین نماید ۲) فقط می تواند جهت تغییر گونه ها را تعیین نماید

۳) در شرایطی می تواند باعث سازش پذیری فرد با محیط شود ۴) همواره باعث برهم زدن تعادل جمعیت می شود

۱۱۵- هر عاملی که بر ……………………………. جمعیت مؤثر است، قطعه ……………

۱) فراوانی اللهای ناسازگار – می تواند باعث پیدایش الل های جدید شود

۲) تغییر ساختار ژنی – در تعیین جهت تغییر گونه ها بی تأثیر است

۳) تنوع افراد – در تغییر خزانه ژن جمعیت نقش اساسی دارد

۴) تغییر چهره – باعث حذف کامل الهای نامطلوب میشود

۱۱۶- کدام عامل توان بقای جمعیت را افزایش میدهد؟

۱) شارش ژنی در جمعیت مبدا ۲) افزایش همانندی

۳) تولیدمثل جنسی به جای تولیدمثل غیر جنسی ۴) کاهش اندازه جمعیت

۱۱۷ کدام عبارت درباره یک جمعیت طبیعی نادرست است؟

۱) بیش از یک عامل می تواند سبب افزایش تنوع الل های آن شود.

۲) انتخاب طبیعی می تواند در جهت افزایش نوعی از الل های آن عمل کند.

۳) کاهش توان زیستی افراد می تواند ناشی از افزایش تنوع الل های آن باشد.

۴) هر عامل تغییردهنده فراوانی اللهاء بر کاهش الل های نامطلوب آن مؤثر است.

۱۱۸- در جمعیتی فرضی و تعادلی برای صفتی با دو الل ه و A، سه نوع ژنوتیپ وجود دارد. اگر افراد این جمعیت خود لقاحی انجام دهند فراوانی اولیه افراد …………………………………… همانند افراد……….خواهد یافت.

۱) ناخالص – خالص، کاهش ۲) مغلوب – غالب، افزایش

۳) ناخالص – غالب، کاهش ۴) غالب – مغلوب، افزایش

پرسشهای جای خالی

۱۱۹- اندامهایی که در گونه های مختلف طرح ساختاری یکسان و وظیفه متفاوت دارند را………………………… و ساختارهایی که وظیفه یکسان و طرح ساختاری متفاوتی دارند را …………………………………………. می نامند.

۱۲۰- زیست شناسان از ساختارهای ……………… برای رده بندی جانداران استفاده می کنند و جانداران……………. را در یک گروه قرار میدهند.

۱۲۱- مارها از تغییر یافتن ………………….. به وجود آمده اند و بقایای پا در لگن مار پیتون به صورت…………… موجود است.

۱۲۲- از جانداران امروزی که در گذشته وجود نداشته اند می توان ……….که در رزین گیاهان به دام افتاده اند.

۱۲۳- ممکن است کل بدن یک جاندار سنگواره شده باشد، مثل ………منجمدشده و ….

۱۲۴- ساختارهای …………………. رد پای تغییر گونه ها هستند و علت مشاهده این ساختارها جلوگیری از……………………….. است.

۱۲۵- در جدول زیر، هر یک از گزاره ها با یکی از واژه ها ارتباط منطقی دارد. شماره واژه مرتبط را داخل آبنویسید.

ردیفواژهگزارهشمارۀ وازۀ مرتبط
۱ساختارهای همتامقایسه اجزای پیکر جانداران گونه های مختلف 
۲ساختارهای وستیجیالساختارهای مشابه با وظایف متفاوت 
۳ساختارهای آنالوگساختارهای متفاوت با وظایف مشابه 
۴گونه های خویشاوندگونه هایی با نیای مشترک 
۵سنگوارهساختارهایی که در گذر زمان کوچک و ساده شده اند. 
۶آناتومی مقایسه ای  

درستی یا نادرستی جملات زیر را مشخص کنید. (در جملات نادرست، زیر عبارت های غلط خط کشیده و درست آنها را بنویسید.)

۱۲۶- سنگواره ممکن است حاوی هیچ بخشی از پیکر موجود زنده نباشد.

۱۲۷- گربه جانداری است که برخلاف درخت گیسو در گذشته دور بر روی کره زمین وجود نداشته است.

۱۲۸- در آناتومی مقایسه ای اجزای پیکر جانداران یک گونه با هم مقایسه می شوند.

۱۲۹- اندامهای همتا از نظر شکل ظاهری شبیه هم هستند.

۱۳۰- ساختارهای آنالوگ دارای طرح و ساختار متفاوت هستند اما وظیفه آنها یکسان است.

۱۳۱- زیست شناسان از ساختارهای آنالوگ برای رده بندی جانداران استفاده می کنند.

۱۳۲- ساختارهای وستیجیال ممکن است وظیفه خاصی نیز بر عهده داشته باشند.

۱۳۳- وجود اندام های وستیجیال در یک جاندار نشان دهنده تکامل آن جاندار است.

به پرسش های زیر پاسخ کوتاه دهید.

۱۳۴- در کدام شاخه از علوم زیستی به مطالعه سنگواره ها می پردازند؟

۱۳۵- در مجموع سنگوارهها چه چیزی را نشان میدهند؟

۱۳۶- وجود ساختارهای همتا در گونه های مختلف نشان دهنده چیست؟

۱۳۷ – مارها از تغییر چه جانداری به وجود آمده اند؟ ۰ به پرسش های زیر پاسخ کامل دهید.

۱۳۸- سنگواره چیست و سنگوارهها چه چیزی را نشان میدهند؟

۱۳۹ – ساختارهای همتا و ساختارهای آنالوگ را با هم مقایسه کنید.

۱۴۰- به چه ساختارهایی وستیجیال گفته می شود و وجود این ساختارها نشان دهنده چیست؟

-۱۴۱ به نظر شما کدام ساختارهای بدن انسان را می توان وستیحیال محسوب کرد؟

۱۴۲- آناتومی مقایسه ای چه اطلاعاتی در اختیار دانشمندان قرار می دهد؟

۱۴۳- آیا از همه جانداران گذشته سنگواره هایی باقی مانده است؟ چرا؟

۱۴۴- اندام های همتا برخلاف اندام های آنالوگ دارای ………..

۱) وظیفه و ساختار مشابه

۲) طرح ساختاری مشابه

۱۴۵- ساختارهای وستیجیال نشان دهنده ………….. است.

۱) مصرف زیاد انرژی توسط آن اندام

۲) نداشتن کارایی آن ساختار

۱۴۶- وجود اندام وستیجیال در یک جاندار نشان دهنده ……..

( ۱) وجود رابطه بین آن جاندار با گروههای دیگر

۲) موفق تریودن آن جاندار نسبت به سایر جانداران

۱۴۷- کدام یک از موارد زیر در مورد سنگواره نادرست است؟

۱) سنگواره می تواند حاوی بخش های نرم بدن نیز باشد. ۲) سنگواره قطعأ حاوی اسکلت درونی یا بیرونی جاندار است.

۳) مطالعه سنگواره ها در شاخه خاصی به نام دیرینه شناسی صورت می گیرد.

۴) از مطالعه سنگواره ها می توان به تغییرات جانداران در طول زمان پی برد.

۱۴۸- کدام یک از ساختارهای زیر نسبت به بقیه همتا نیست؟

۱) باله دلفین ۲) بال پروانه ۳) بال کبوتر۴) بال خفاش

۱۴۹- کدام یک از ساختارهای زیر در انسان، ساختاری وستیجیال محسوب می شود؟

۱) ماهیچه های مژگانی ۲) استخوان چکشی

۳) آپاندیس ۴) دندان نیش

۱۵۰- اندامهای همتا ……………………………………………………… اندام های آنالوگ ………. هستند.

۱) برخلاف – دارای وظیفه مشابهی

۲) برخلاف – دارای اساس ساختاری یکسانی

۳) همانند – دارای وظایف مشابهی

۴) همانند – دارای اساس ساختاری یکسانی

۱۵۱- چند مورد از موارد زیر نادرست است؟

الف) پیدایش کوسه ماهی در گذشته دورتری از پیدایش دلفین رخ داده است.

ب) یوزپلنگ و کوسه ماهی نیای مشترک ندارند.

پ) یوزپلنگ و دلفین و کوسه ماهی در گذشته از گونه مشترکی مشتق شده اند.

ت) نیای مشترک یوزپلنگ و دلفین به زمان حال نزدیک تر است تا نیای مشترک دلفین و کوسه.

۱)۱ ۲)۲ ۳)۳ ۴)۴

۱۵۲- در رابطه با ساختارهای همتا و آنالوگ کدام گزینه درست است؟

۱) دست انسان نسبت به بال مگس آنالوگ است. ۲) بال پرنده نسبت به بال خفاش همتا است

۳) بال مگس و بال پشه نسبت به هم آنالوگ هستند. ۴) بال گنجشک نسبت به بال عقاب وستیجیال محسوب می شود.

  • جاهای خالی را با کلمات مناسی پر کنید.

۱۵۳- ………………………. به جانداری گفته میشود که زنده می ماند و زندگی………………….. خود را ادامه می دهد.

۱۵۴- در گونه زایی دگرمیهنی وقوع پدیده هایی مانند ………….. و انتخاب طبیعی باعث متفاوت شدن دو جمعیت با هم می شوند.

۱۵۵- در زیست شناسی گونه به جاندارانی گفته می شود که می توانند در…………………… با هم آمیزش کنند و فرزندانی ……………………….. و……… به وجود آوردند.

۱۵۶- هر چه شباهت توالیهای حفظ شده در دو گونه ………………………………… باشد میزان……………………… آنها بیشتر است.

۱۵۷- اصولا هر چه در طول زمان حفظ شده باشد از ……………………….. پراهمیت برخوردار است زیرا هرگونه تغییر در آن به ……………………….. یا مرگ منجر شده است.

۱۵۸- اگر میان افراد یک گونه جدایی ……………………… رخ دهد، آن گاه ………………………. آنها از یکدیگر جدا می شود و احتمال تشکیا جدید فراهم می شود.

  • درستی یا نادرستی جملات زیر را مشخص کنید. (در جملات نادرست، زیر عبارت های غلط خط کشیده و درست آنها را بنویسید.)

۱۶۰- از آمیزش بین افراد گونه های مختلف فرزندانی به وجود می آیند که قطعا زیستا نیستند.

۱۶۱- در گونه زایی دگرمیهنی برخلاف گونه زایی هم میهنی خطای میوزی نقش اصلی را دارد.

۱۶۲- توالیهای حفظشده بخشی از رونوشت دنا هستند که در گونه های مختلف دیده میشوند.

۱۶۳- گونه زایی هم میهنی برخلاف گونه زایی دگرمیهنی نیاز به قطع شارش ژنی ندارد.

۱۶۴- دو جانداری که با هم آمیزش می کنند و از آمیزش آنها فرزندانی زیستا به وجود می آید ممکن است متعلق به دو گونه مختلف باشند.

۱۶۵- عوامل جداکننده خزانه ژن گونه های مختلف ممکن است بعد از لقاح وارد عمل شوند. و پرسشهای تشریحی و به پرسش های زیر پاسخ کوتاه دهید.

۱۶۶- به چه جانداری زیستا گفته می شود؟

۱۶۷- کدام پدیده باعث تشکیل گامت هایی با عدد کروموزومی غیرطبیعی می شود؟

۱۶۸- منظور از خود لقاحی گیاهان چیست؟

۱۶۹- منظور از آمیزش موفقیت آمیز چیست؟ د به پرسش های زیر پاسخ کامل دهید

۱۷۰- توضیح دهید که چگونه از گیاهان دیپلوئید گیاهانی تتراپلوئید به وجود می آیند؟

۱۷۱- توضیح دهید که چگونه از گیاهان دیپلوئید گیاهانی تریپلوئید به وجود می آید؟

۱۷۲- آیا گیاهان تریپلوئید یک گونه محسوب می شوند؟ چرا؟

۱۷۳- در گونه زایی دگرمیهنی چه عواملی باعث افزایش تفاوت بین گونه ها می شود؟

۱۸۶- برای گونه زایی دگرمیهنی ابتدا ……………………………………

۱) تنها، عامل تغییردهنده اللها فعال گردیده است

۲) همه عوامل مؤثر بر تغییر فراوانی اللها دست به کار می شوند

۳) برخی از اعضای جمعیت متحمل تغییرات ناگهانی و جدایی تولیدمثلی می شوند

۴) یکی از عوامل مؤثر بر تغییر خزانه ژن جمعیت باید متوقف شود

۱۸۷- گیاهی به طور معمول گامتهای ۲n کروموزومی تولید می کند. این گیاه قطعا ………

۱) نمی تواند گامتهای ۴n کروموزومی ایجاد نماید

۲) از یاخته تخم ۲n کروموزومی ایجاد شده است

۳) نمی تواند والدین ۲n کروموزومی داشته باشد

۴) از یک زیگوت ۴n کروموزومی به وجود آمده است

۱۸۸- چند مورد از جملات زیر درست نیست؟

الف) در گونه زایی هم میهنی تغییرات تدریجی باعث جدایی تولیدمثلی می شود.

ب) در گونه زایی دگرمیهنی تغییرات ناگهانی باعث جدایی تولیدمثلی می شود.

پ) در گونه زایی هم میهنی برخلاف گونه زایی دگرمیهنی جدایی تولیدمثلی رخ نمی دهد.

ت) در گونه زایی هم میهنی همانند گونه زایی دگر میهنی جدایی تولیدمثلی رخ می دهد.

۱)۱ ۲)۲ ۳)۳ ۴)۴

۱۸۹- کدام گزینه نازیستابودن زاده های حاصل از آمیزش دو گونه مختلف را نشان می دهد؟

۱) در گیاهی دورگه، دانه گرده بر روی کلاله قرار می گیرد اما لوله گرده تشکیل نمی شود.

۲) جاندار دورگه قادر به تولید اسپرم های فعال نیست.

۳) زیگوت های حاصل از آمیزش دو گونه مختلف رشد و نمو نمی کنند.

۴) جاندار دورگه دارای عدد کروموزومی ۱۵ = n۳ است

۱۹۰- دورگه حاصل از آمیزش بز و گوسفند در مراحل ابتدایی دوران جنینی از بین می رود. این موضوع نشان دهنده کدام مورد است؟

۱) جانداران دورگه معمولا نازا هستند.

۲) اسپرم و تخمک گونه های مختلف نمی توانند با هم لقاح انجام دهند.

۳) جاندار دورگه ممکن است نازیستا باشد.

۴) جاندار دورگه ممکن است زایا و زیستا باشد.

۱۹۱- در کدام یک از جانداران زیر احتمال گونه زایی دگرمیهنی کمتر است؟

۱) نوعی پرنده ۲) پلنگ

۳) نوعی گیاه دوجنسی ۴) ماهی

۱۹۲- چند عبارت در مورد گونه زایی دگرمیهنی درست است؟

الف) ایجاد ست جغرافیایی به این پدیده کمک می کند اما الزامی نیست.

ب) هر چه اندازه دو جمعیت کوچک تر باشد احتمال گونه زایی کمتر است.

پ) جهش باعث واگرایی و افزایش تفاوت خزانه ژن در جمعیت می شود.

ت) افراد مهاجر باید ارتباط خود را با جمعیت مادر از دست بدهند.

۱)۱ ۲)۲ ۳)۳ ۴)۴

۱۹۳- پیدایش گیاهان پلی پلوئید نوعی گونه زایی ……………………………… است که در اثر…………….رخ داده است.

۱) هم میهنی – ایجاد مانع جغرافیایی

۲) هم میهنی – تخریب رشته های دوک

۳) دگرمیهنی – ایجاد مانع جغرافیایی

۴) دگر میهنی – تخریب رشته های دوک

۱۹۴- نقش مانع جغرافیایی در گونه زایی دگرمیهنی چیست؟

۱) جلوگیری از رانش اللی در دو جمعیت

۲) جلوگیری از شارش ژن بین دو جمعیت

۳) جلوگیری از انتخاب طبیعی

۴) ایجاد شرایط محیطی متفاوت برای دو جمعیت

۱۹۵- چند عبارت صحیح است؟

الف) تشکیل گیاهانی که گامت هایn ۲دارند نوعی گونه زایی دگرمیهنی است.

ب) توقف جهش در گونه زایی دگرمیهنی سرعت گونه زایی را کند می کند.

پ) شارش ژن می تواند باعث افزایش تفاوت جمعیتها شود.

ت) اگر انتخاب طبیعی رخ ندهد شانس بقای همه افراد با هم برابر است.

۱)۱ ۲)۲ ۳)۳ ۴)۴

۱۹۶- کدام گزینه گونه زایی هم میهنی و گونه زایی دگرمیهنی را به ترتیب نشان می دهد؟

۱) پیدایش گونه ای جدید از مارمولک پس از پیش روی یخچال – گیاهان پلی پلوئید

۲) گیاهان پلی پلوئید – پیدایش گونه جدیدی از سنجاب که در دو سوی یک دره زندگی می نمایند.

۳) سنجاب هایی که در دو سوی یک دره زندگی می نمایند . پیدایش گونه ای از مارمولک پس از پیش روی یخچال

۴) سنجاب هایی که در دو سوی یک دره زندگی می کنند – گیاهان پلی پلوئید

۱۹۷ – گونه زایایی در اثر آمیزش گامت های طبیعی در گیاه با عدد کروموزومی ۲۸ = n ۴و ۱۴ = n۲ به وجود آمده است. این گونه دارای…………. کروموزوم است.

۱)۳ دست ۲)۲۱ عدد ۳)۴ دست ۴)۴۲ عدد

۱۹۸- می توان گفت که میزان بزرگی مانع جغرافیایی برای گونه زایی دگرمیهنی به………………… بستگی دارد.

۱) میزان اندازه جمعیت ۲) اندازه پیکر افراد جمعیت

۳) میزان تحرک افراد جمعیت ۴) میزان تراکم جمعیت

۱۹۹- کدام یک باعث پیدایش گیاهان تتراپلوئید نمی شود؟

۱) ترکیب گامت های دو فرد از دو گونه گیاه دیپلوئید و تتراپلوئید

۲) ترکیب گامتهای n ۲ (ناشی از جدانشدن کروموزوم ها) بین دو فرد از یک گونه گیاه دیپلوئید

۳) ترکیب گامت های یک گونه و ایجاد یاخته تخم n ۲و جدانشدن تمام کروماتیدهای خواهری در اولین تقسیم میتوزی

۴) آمیزش بین دو گونه مختلف و ایجاد یاخته تخم n ۲و جدانشدن تمام کروماتیدهای خواهری در اولین تقسیم میتوزی

محتوای تب

به نام خدا

سوالات امتحان درس زیست شناسی۳ دبیرستان امام حسین (ع)
۱۳۹۷ نام کلاس: مدت امتحان:۸۰دقیقه
نام و نام خانوادگی: نام دبیر:خاقانی
ردیف متن سوالات نمره
۱  درستی با نادرستی عبارات زیر را مشخص کنید.(از کلمات غلط و صحیح استفاده کنید.)

أ‌)        صفت گروه خونی Rh یک صفت پیوسته و تک جایگاهی است.

ب‌)     مقدار یوراسیل موجود در mRNA همیشه با مقدار آدنین برابر است.

ت‌)     تعدادرمزه ها درmRNAهای تمامی جانداران یکسان است.

ث‌)     DNAی  باکتری های حاصل از دور اول همانندسازی در محیط کشت حاوی ۱۴Nپس از گریز دادن نواری در انتهای لوله تشکیل دادند.

۲
۲ جاهای خالی را با کلمات(  جرم ،کدون ، چگالی ، ناقل ، فنیل کتونوری) مناسب پر کنید.

أ‌)        در سانتریفوژ میزان …………. مواد بر اساس ……………… است.

ب‌)     به توالی های ……نوکلئوتیدی mRNA ،…………… می گویند.

ت‌)     منظور از ……….. فردی است که بیمار نیست اما………..بیماری را دارد.

ث‌)     با تغذیه نکردن از خوراکی هایی که ………… دارند، می توان مانع بروز اثرات بیماری …………… شد.

۲
۳ در مورد انواع مولکول RNA به سؤالات زیر پاسخ دهید:

الف ) با توجه به این نکته که مولکول tRNA تک رشته ای است، بخش های دو رشته ای موجود در مولکول tRNA چگونه حاصل شده است ؟

ب) کدون اولین آمینو اسید در هر زنجیره پلی پپتیدی بر روی mRNA چیست ؟

۱
۴ در مورد ساختار شیمیایی نوکلئیک اسید، به سؤالات زیر پاسخ دهید:

الف) در حالت طبیعی، نوعی باز آلی که در ساختار DNA شرکت ندارد را بنویسید.

ب)پیوند بین نوکلئوتیدهای موجود در یک رشته پلی نوکلئوتیدی، چه نام دارد؟

۱
۵ الف) اگر ترتیب بازهای یک رشته ی DNA به صورت TCGAAGCT باشد، ترتیب بازهای رشته ی دیگر چیست ؟

ب) آنزیم هلیکاز ، در همانند سازی DNA چه نقشی دارد؟

۱
۶ شکل زیر مربوط به چه ساختاری است؟ محل مشخص شده را نامگذاری کنید.

.

۱
۷ گریفیت برای بررسی این که آیا کپسول عامل مرگ موش هاست یا خیر، چه آزمایشی را انجام داد. ۱
۸ به سوالات زیر در مورد تنظیم بیان ژن در پروکاریوت ها پاسخ دهید.

الف) در حضور کدام ماده ، مهار کننده به اپراتور متصل باقی می ماند؟

ب)در هنگام حضور مالتوز، رونویسی ژن مربوط به آنزیم تجزیه کننده مالتوز، توسط کدام آنزیم صورت می گیرد؟

۱
۹ اگر فردی برای گروه خونی ABO فقط آنزیم A را داشته باشد؟

۱٫        گروه خونی این فرد چیست؟

۲٫       این آنزیم توسط کدام الل بیان شده است؟

۱
۱۰ یکی از اصطلاحات « خالص» یا  « ترجمه » را تعریف کنید ۱
۱۱ در مورد ترجمه به سوالات زیر پاسخ دهید؟

أ‌)        در کدام مرحله ریبوزوم روی mRNA جابجا می شود؟

ب‌)     در کدام مرحله همۀ اجزای ترجمه از یکدیگر جدا می شود؟

۱
۱۲ در مور توالی نوکلئوتیدی در mRNAی زیر به پرسش ها پاسخ دهید.

mRNA = UAAGUCAUGUUUCCGUGGAAUUGAAAU

الف)اولین پادرمزه که وارد جایگاه A ریبوزوم می شود کدام است؟

ب)آخرین رمزه که در جایگاه P ریبوزوم قرار می گیردف کدام است؟

پ)رمزه پایان در کدام جایگاه ریبوزوم قرار می گیرد؟

ت) پلی پپتید ساخته شده چند آمینو اسید دارد؟

۱
۱۳ چرا در زیر میکروسکوپ الکترونی، اندازه رناهای ساخته شده هنگام رونویسی متفاوت دیده می شود؟ ۱
۱۴ الف)انواع ژنوتیپ های احتمالی برای صفت رنگ گل میمونی را ذکر کنید.

ب)در فونو تیپ گرو های خونی رابطه بین کدام الل ها هم توانی است؟

۱
۱۵ در رابطه با بیماری هموفیلی به سوالات زیر پاسخ دهید.

أ‌)        الل مربوط به این بیماری روی کدام کروموزوم قرار دارد؟

ب‌)     شایع ترین نوع هموفیلی مربوط است به کمبود کدام عامل است؟

۱
۱۶ اگر زنی ناقل هموفیلی و ناقل فنیل کتونوری با گروه خونی O  با مردی هموفیل و مبتلا به PKU با گروه خونی AB ازدواج نماید. چقدر احتمال دارد اولین فرزند آنها گروه خونی B را داشته باشد؟ ۱
۱۷ الف) از آمیزش ذرت با ژنوتیپAABBCC با ذرت با ژنوتیپ  aabbcc  زاده های  حاصل در کدام طیف قرار می گیرند؟

ب)ژنوتیپ زاده ها ی حاصل از این آمیزش را بنویسید.

۱
۱۸ زنی با گروه خونی B با مردی با گروه خونی A که هردو دارای ژنوتیپ ناخالص هستند، ازدواج می کند.

۱٫        انواع فنوتیپ های جدید احتمالی در فرزندان کدامند؟

۲٫       احتمال تولد فرزندی با گروه خونی O چقدر است؟

۱
مجموع نمرات ۲۰

موفق و پیروز باشید.

به نام خدا

سوالات امتحان درس زیست شناسی ۲ دبیرستان امام حسین (ع)
۱۳۹۷ نام کلاس: مدت امتحان:۸۰دقیقه
نام و نام خانوادگی: نام دبیر:خاقانی
ردیف متن سوالات نمره
۱ درستی با نادرستی عبارات زیر را مشخص کنید.(از کلمات غلط و صحیح استفاده کنید.)

أ‌)        در بیماری دیابت شیرین ، بر اثر تجزیۀ چربی ها PH خون کاهش می یابد.

ب‌)     بافت استخوانی فشرده در دو سر استخوان ران، به صورت واحدهایی به نام سامانۀ هاورس قرارگرفته است.

ت‌)     در پلاناریا دو گره عصبی در سر جانور، مغز را تشکیل داده اند.

ث‌)     حساسیت یاخته های مخروطی به نور ، بیشتر از استوانه ای ها است.

۲
۲ از کلمات (  سریع، آمینو اسید ها، قدرتی . مجرای شنوایی ،دور برد ، پرده صماخ ، برخی دارو ها . جریان خون ، تند ،)جا های خالی را با کلمات مناسب پر کنید.

أ‌)        در انتهای…………………………… استخوان چکشی …………………………..قرار دارد.

ب‌)     موادی مانند ………………………………    و ……………. …… از سد خونی مغزی عبور می کنند.

ت‌)     پیک های ……………………  پیک هایی هستند که به…………………………….. وارد می شوند.

ث‌)     تار ماهیچه ای نوع ………………..برای  انقباظات………………. و …………………………..متخصص شده اند؟

۲
۳ از اصطلاحات زیر یکی را تعریف کنید.

الف)لکه زرد         ب) اعتیاد

۱
۴ نوع گیرنده ها را درهر یک مشخص کنید:

گیرنده اکسیژن در آئورت:

گیرنده های فرو سرخ:

۱
۵ در مورد پتانسیل عمل به سوالات زیر پاسخ دهید.

در شروع پتانسیل عمل کدام کانال های دریچه دار باز می شوند؟

در پایان پتانسیل عمل کدام پروتئین فعالیت خود را افزایش می دهد؟

۱
۶ اسکلت بیرونی در حشرات و حلزون ها به ترتیب چه نقشی دارند؟

هدایت جهشی در کدام نوع نورون ها دیده می شود؟

۱
۷ در تشریح چشم به سوالات زیر پاسخ دهید؟

عنبیه شامل چه ماهیچه هایی است؟

چرا زلالیه بطور کامل شفاف نیست؟

۱
۸ ویژگی مهم گیرنده های درد چیست؟

چرا بعد از مدتی اثرات درد و گرفتکی ماهیچه ای کاهش مییابد؟

۱
۹ وظیفۀ هر یک را بنویسید.

شیپور استاش:

لالۀ گوش:

۱
۱۰ چه بخش از اسکلت استخوانی بدن در تولید یاخته های خونی دخالت دارد؟

ماهیچه ها چگونه در حفظ دمای بدن دخالت می کنند؟

۱
۱۱ بخش های مشخص شده را نامگذاری کنید. ۱
۱۲ در مورد هورمون های بخش پسین هیپوفیز به سوالات زیر پاسخ دهید.

الف) در کجا ساخته می شود؟

ب)نام آنها را بنویسید.

۱
۱۳ در هر یک از حالات زیر نوع ماهیچه را مشخص کنید.

افراد کم تحرک:

وزنه بردار:

۱
۱۴ در مورد انعکاس ها پاسخ دهید.

الف) توسط کدام  بخش دستگاه عصبی محیطی تنظیم می شود؟

ب)مرکز تنظیم این انعکاس ها کدام بخش است؟

۱
۱۵ هر یک از اعمال زیر توسط کدام بخش مغز انجام می گیرد؟

الف) تنظیم تعداد ضربان قلب:

ب)پردازش نهایی اطلاعات حسی:

۱
۱۶ در مورد دیابت نوع ۲ به سوالات زیر پاسخ دهید.

الف) در چه افرادی ظاهر می شود؟

ب) یک مورد از راه های پیشگیری آن را بنویسید.

۱
۱۷ هریک از اعمال زیر توسط کدام هورمون انجام می گیرد؟

الف) افزایش فشار خون:

ب) نمو دستگاه عصبی:

۱
۱۸ هر یک از هورمون های زیر در چه بخشی ساخته می شود؟

الف) هومون پرولاکتین:

ب)اکسی توسین

۱
مجموع نمرات ۲۰

موفق و پیروز باشید

بسمه تعالی دبیرستان امام حسین (ع)

امتحان میان ترم درس زیست شناسی۳

نام و نام خانوادگی:

نام دبیر: خاقانی

مدت امتحان:۸۰دقیقه

ردیف سوالات نمره
۱ درستی یا نادرستی جملات زیر را بنویسید.(از کلمات درست و غلط استفاده کنید)

أ‌)        جفت شدن بازهای مکمل، اصل چارگف را توجیه می کند.

ب‌)     پس از اتصال بخش بزرگ و کوچک ریبوزوم به یکدیگر، tRNA آغازگر با کدون آغاز رابطۀ مکملی برقرار می کند.

ت‌)     رخ نمود صفات تک جایگاهی، غیرپیوسته است.

ث‌)     در افراد PKU آنزیم سازندۀ فنیل آلانین وجود ندارد.

۲
۲ از کلمات (فسفو دی استر،هیدروژنی) استفاده و جاهای خالی را پر کنید.

أ‌)        در یک رشته پلی نوکلئوتیدی ، پیوند بین دو نوکلئوتید را پیوند …………………….. می نامند.

ب‌)     رمزه آغاز باعث آغاز ………………… می شود و معرف اسید آمینه ……………….. است.

ت‌)     بیش از کشف قوانین وراثت ، توسط .دانشمندی به نام…………… تصور بر این بود که صفات فرزندان ……………. از صفات والدین و ……………………. از آنهاست.

ث)در گروه خونی ABO بین الل های A و O رابطه ………بارز و نهفته………. و بین الل های B و Aرابطه……هم توانی……… وجود دارد.

ج)     هموفیلی یک بیماری ……………….. است و الل مربوط به این بیماری روی کروموزوم……………………… قرار دارد

۲
۳ أ‌)        گریفیت برای بررسی این که آیا کپسول عامل مرگ موش هاست یا خیر، چه آزمایشی را انجام داد وچه مشاهده کرد؟

ب‌)     بین قند یک نوکلئوتید و فسفات نوکلئوتید دیگر در مولکول دنا چه پیوندی بر قرار است؟

ت‌)     برای بیان نوع آمینو اسید در پلی پتتید ، توالی نوکلئوتیدی رمز دنا چند تایی است؟

۱
۴ به پرسش های زیر در مورد تنظیم بیان ژنها پاسخ دهید:

أ‌)        توالی افزاینده در کدام نوع سلولها وجود دارد ؟

ب‌)     مانعی که در تنظیم منفی رو نویسی از پیش روی رنا بسپاراز، جلوگیری می کند کدام است؟

ت‌)     تنظیم بیان ژن در مورد ژن آنزیم تجزیه کننده مالتوز در اشرشیا کلای از کدام نوع است؟

۵/۱
۵ انواع پروتئین های ساختاری و نقش آن را بنویسید. ۱
ردیف

ادامه سوالات

نمره
۶ به سؤالات زیر پاسخ دهید:

الف) در همانند سازی DNA ، انزیم هلیکاز موجب گسستگی کدام پیوندهای این مولکول می شود؟

ب) تعداد دوراهی همانندسازی را در باکتری ها و سلولهای یوکاریوتی با هم مقایسه کنید

۱
۷ ادامه سوالات

  1. دمای بالا چه تاثیری در فعالیت انزیم ها دارد؟
  2. چرا در زیر میکروسکوپ الکترونی، اندازه رناهای ساخته شده هنگام رونویسی متفاوت دیده می شود؟
نمره
۸ اگزون(بیانه) را تعریف کنید. ۱
۹ ‌أ)        ساختار سوم پروتئین ها چگونه بوجود می آیند؟

‌ب)     اگر ترتیب نوکلئوتید ها در یک رشته دنا TACGATGC باشد، ترتیب نوکلئوتید ها در رشته مکمل ان را بنویسید.

‌پ)      در پیش هسته ای ها رونویسی توسط کدام آنزیم انجام می گیرد؟

‌ت)       در رونویسی مکمل نوکلئوتید آدنین دار کدام نوکلئوتید قرار می گیرد؟

۲
۱۰ منظور از دنای هسته ای چیست؟ ۱
۱۱ منظوراز فعالیت نوکلئازی دنابسپاراز چیست؟

آزمایشات مزلسون و استال چه نتیجه ای نشان داد؟

۱
۱۲ شکل را نام گذاری کنید.

الف)هر یک از شکل الف ، ب و پ کدام حالت را نشان می دهند.

ب) کدام حالت فعال رنا ناقل است؟

ج)کدام شکل حاصل تا خوردگی اولیه رنای ناقل است؟

                                                                                                          الف                     ب                        پ            

۱
۱۳ در مورد ترجمه به سوالات زیر پاسخ دهید.

۱٫        در مرحلۀ آغاز ، رنای ناقلی که مکمل رمزه آغاز است در کدام جایگاه قرار می گیرد؟

۲٫        جایگاه P محل قرار گیری کدام رنا است؟

۳٫        در مرحلۀ آغاز ، جایگاه P در رناتن ابتدا توسط کدام رنا اشغال می شود؟

۴٫        جایگاه A رناتن محل قرار گیری کدام رنا است؟

۱
۱۴ در مبحث ژنتیک به چه افرادی ناقل می گویند؟ ۱
۱۵ به سوالات زیر پاسخ کوتاه دهید.

۱)       انواع ژنوتیپ های احتمالی برای فردی که گروه خون B دارد را بنویسید.

۲)      در چه حالتهایی می توان با دیدن فنوتیپ، ژنوتیپ را تشخیص داد؟

۱
۱۶  هر یک از صفات زیر از کدام الگوی ورانتی تبعیت می کند؟

۱٫        رنگ موهای اسب

۲٫       حالت موی انسان

۱
۱۷ ۱)       مثبت یا منفی بودن گروه خون به چه چیزی بستگی دارد؟

۲)      در چه صورتی فرزندان تمام ژن های خود را از یک والد دریافت می کنند؟

۱
۱۸ مردی با گروه خونی A با زنی با گروه خونی B که هر دو دارای ژنوتیپ ناخالص هستند، ازدواج می کند.

۱٫        انواع فنوتیپهای جدید احتمالی در فرزندان کدامند؟

۲٫       احتمال تولد فرزندی با گروه خونی A چقدر است ؟

۱
۱۹ اگر مردی هموفیل با زنی ناقل هموفیلی ازدواج کند، چه قدر احتمال دارد اولین پسر آنها مبتلا به هموفیلی باشد؟ ۱
۲۰ صفات تک جایگاهی و صفات چندجایگاهی را تعریف کنید. ۱
مجموع نمرات ۲۰

موفق و پیروز باشیدو نمرات خوب بگیرید. خاقانی

به نام خدا امتحان نوبت اول در س زیست شناسی۳ وقت: نمره
اداره آموزش و پرورش ملکان نام و نام خانوادگی: دبیر: خاقانی
دبیرستان امام حسین (ع) نام کلاس:………… دی ماه ۱۳۹۷
ردیف سوالات نمره
۱ صحیح یا غلط بودن عبارات زیر را مشخص کنید.

آ) مکمل بودن باز های آلی در مولکول رنا(RNA) نتایج آزمایش های چارگاف را تائید می کند. غلط.

ب) انرژی لازم  برای تهیه پلی پپتید  از مولکول های پر انرژی مانندATP  به دست می اید. صحیح .

پ) در هم توانی صفت در حالت ناخالص، به صورت حد واسط حالت های خالص مشاهده می شود.. غلط .

ت) مقاوم شدن باکتری ها نسبت به داروها، نشان دهندۀ این است که موجودات زنده می توانند در گذر زمان تغییر کنند. صحیح .

۲
۲ جاهای خالی را با کلمات مناسب پر کنید.

آ)گریفیت باکتری های پوشینه دار کشته شده با گرما را به موش ها تزریق کردو موش ها …….. سالم ماندند………………………….

ب) نواحی که درمولکول دنا وجود دارد ولی رونوشت آن در رنای پیک سیتوپلاسمی حذف شده …………. میانه )اینترون)…..  می گویند.

پ) رخ نمود صفات …….. تک جایگاهی……………..، غیرپیوسته است. در صورتی که رخ نمود …….. صفات چند جایگاهی…………….. رخ نمود های پیوسته ای دارند.

ت) ژنگان به کل محتوای مادۀ وراثتی گفته می شود و برابر است با…… مجموع محتوای مادهٔ وراثتی هسته ای وسیتوپلاسمی………………………..

۲
۳ گزینۀ مناسب را انتخاب کنید.

آ)کدام گزینه نتایج آزمایش های ایوری و همکارانش را بدرستی بیان می کند.

عامل اصلی و مؤثردر انتقال صفات، دِنا است.                                                                    عامل اصلی و مؤثردر انتقال صفات، پروتئین است

ب)در فرایند ترجمه کدام گزینه شرکت دارد؟

رنا بسپاراز                                                                                                                                   رنا تن

پ)در بیماری فنیل کتونوری (PKU) کدام مورد وجود ندارد.

آمینو اسید فنیل آلانین                                                                                                            آنزیم تجزیه کنندۀ فنیل آلانین

ت) کدام گزینه گونه زایی هم میهنی را بهتر بیان می کند.

پدیدۀ کوه زایی                                                                                                                          پدیدۀ چند لادی

۲
۴ به پرسش های زیر پاسخ  کوتاه دهید.

آ) منظور از جایگاه فعال آنزیم چیست؟  جایگاه فعال بخشی اختصاصی در آنزیم است که پیش ماده  در آن قرار می گیرد.

ب) تغییر شکل گویچۀقرمز در بیماری ،کم خونی حاصل از گویچه های قرمز داسی شکل ، مربوط به کدام پروتئین است؟ هموگلوبین

پ) در تولید مثل جنسی ،  ارتباط بین نسل ها توسط کدام یاخته ها بر قرار می ماند؟ یاخته های جنسی (گامت یا کامه)

ت) عاملی که توان بقای جمعیت ها را در شرایط متغیر محیط افزایش می دهد چیست؟ تغییر پذیری مادۀ وراثتی( جهش)

۲
۵ با توجه به شکل به پرسش های زیر پاسخ دھید.

الف) موارد شماره گذاری شده را نام گذاری کنید.

۱-     گروه فسفات

۲-    قند ۵ کربنه

۳-   باز آلی نیتروزن دار

۱٫۵
۶ سه مرحلۀ رو نویسی را نام ببرید. آغاز – طویل شدن – پایان . ۱٫۵
۷ جدول زیر را کامل کنید.

DD,Dd

گروه خونی A

گروه خونی

۱٫۵
۸ نوع جهش را در هر یک از تصاویر زیر مشخص کنید.

۱-     ……..,واژگونی…………..                                    ۲-  …..جابجایی……………….             ۳- …مضاعف شدگی………….

۱٫۵
۹ در مورد همانند سازی به سوالات زیر پاسخ دهید.

آ) کدام آنزیم پیوند های هیدروژنی را می شکند؟ هلیکاز.

ب)کدام آنزیم پیوند فسفو دی استر را می شکند؟  دنا بسپاراز.

۱
۱۰ الف) در چه هنگامی یک آمینو اسید بار مثبت و  منفی به خود می گیرد؟ هنگامی که آمینواسیدی در محیط آبی )یاخته( قرار می گیرد، گروه آمین بارمثبت (+) و گروه کربوکسیل بار منفی (-)به خود می گیرد.

ب)چرا با قرار گرفتن عامل آزاد کننده در جایگاه A ریبوزوم ، ترجمه به پایان می رسد؟چون این پروتئین ها باعث جداشدن پلی پپتید از آخرین رنای ناقل می شوند. همچنین این پروتئین ها باعث جدا شدن زیرواحدهای رِناتَن از هم و آزاد شدن رنای پیک می شوند.

۱
۱۱ در مورد تنظیم منفی بیان ژن به پرسش های زیر پاسخ دهید.

آ)در حضور کدام ماده مهار کننده از توالی  اپراتور جدا می شود؟ لاکتوز

ب) این نوع تنظیم معمولاً در کدام جانداران دیده می شود؟ در پیش هسته ای ها

۱
۱۲ در خانواده ای که مادر ناقل است  دختری با گروه خونی AB  و بیماری هموفیلی متولد شده است. با رسم مربع پانت به سوالات زیر پاسخ دهید.

الف) چقدر احتمال دارد که فرزندی با گروه خونی O متولد شود؟

گامتها i
i ii

مادر ناقل هموفیلی وبا گروه خونی  A   × پدر هموفیلی با گروه خونی B

Y i

ب) احتمال تولد پسری با بیماری هموفیلی چقدر است؟؟

گامتها
X
Y XY

مادر ناقل هموفیلی وبا گروه خونی  A   × پدر هموفیلی با گروه خونی

Y i

۱
۱۳ الف) منظور از ژن نمود خالص چیست؟  یعنی هر دو آلل  مربوط به یک ژن ، در کروموزوم های همتا ، مشابه باشند.(DD,dd).

ب)کدام پدیده می تواند باعث حذف آلل های سازگار، از محیط شود؟ رانش دگره ای

۱
۱۴ در رابطه با تغییر گونه ها به سوالات زیر پاسخ دهید؟

آ) اندام هایی را که طرح ساختاری آنها یکسان است، ولی  کار متفاوتی دارند چه نامیده می شوند؟ ساختار های همتا.

ب) گونۀ جدیدی طی آمیزش گامت های طبیعی دو گیاه با عدد کروموزومی ۲۸ =n4 و ۱۴=n2 به وجود آمده است. گونۀ جدید چند کروموزوم دارد.   کروموزوم  ۲۱ = ۷ +۱۴

۱
مجموع نمرات ۲۰

به نام خدا امتحان وقت: نمره
اداره آموزش و پرورش نام و نام خانوادگی: دبیر:
دبیرستان نام کلاس:............ نوبت امتحان /تاریخ
ردیف متن سوالات نمره
مجموع نمرات

 


 

دعوت برای کمک به  افزایش کارایی این پست.

  • نویسندگی . اگر مایل هستید که سوالات مربوط به این پست را پر بار تر کنید می توانید از از طریق ثبت نام عمل کنید.
  • برنامه نویسی.. پروژه های زیر برای این پست برنامه نویسی کاربردی احتیاج دارد
  • پردازش اطلاعات موجود در بخش پرینت.به این صورت که سوال را انتخاب کرد ، و با زدن دکمه پردازش ، بتوان آن را پردازش کرد. یا کاملاً تغییر داد.
  • سورت شدن اتوماتیک اعدادردیف بعد از حذف سوال. به این صورت که وقتی سوالی را حذف کردیم ردیف ها بصورت اتوماتیک سورت شوند . مثلاً اگر سوال ۵ را حذف کردیم بصورت خودکار ۶به ۵ و ۷به۶ و ۸به ۷ و الا آخر سورت شوند. یعنی مثل نامبرینگ ورد عمل کند.
  •  در سلول مجموع نمرات ،جمع نمره ها بصورت اتوماتیک انجام شود.
  • دکمه ای برای ایجاد یک برگه امتحانی تصادفی برای هر امتحان وجود داشته باشد . به این صورت که وقتی روی دکمه کلیک می شود . یک ورقه امتحانی کامل از سوالات همان درس ،۲۰ نمره ای یا ۱۵ نمرهای که سوالات بصورت تصادفی انتخاب شده اند ایجاد شود.
  • با کلیک کردن روی دکمه پرینت ، پاسخ نامه هر سوال نیز بصورت جداگانه بعد از سوالات پرینت شود .
هر گونه کپی برداری از ایده و طرح ممنوع است.